ID: 902404952

View in Genome Browser
Species Human (GRCh38)
Location 1:16177495-16177517
Sequence TTGTCAAAGGTGCACTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404944_902404952 16 Left 902404944 1:16177456-16177478 CCACCAAGGGGAGAGGTGCCACC No data
Right 902404952 1:16177495-16177517 TTGTCAAAGGTGCACTTTCTTGG No data
902404948_902404952 -5 Left 902404948 1:16177477-16177499 CCATGACCTGGTGCACCATTGTC No data
Right 902404952 1:16177495-16177517 TTGTCAAAGGTGCACTTTCTTGG No data
902404940_902404952 27 Left 902404940 1:16177445-16177467 CCCAGATGCCACCACCAAGGGGA No data
Right 902404952 1:16177495-16177517 TTGTCAAAGGTGCACTTTCTTGG No data
902404943_902404952 19 Left 902404943 1:16177453-16177475 CCACCACCAAGGGGAGAGGTGCC No data
Right 902404952 1:16177495-16177517 TTGTCAAAGGTGCACTTTCTTGG No data
902404947_902404952 -2 Left 902404947 1:16177474-16177496 CCACCATGACCTGGTGCACCATT No data
Right 902404952 1:16177495-16177517 TTGTCAAAGGTGCACTTTCTTGG No data
902404938_902404952 28 Left 902404938 1:16177444-16177466 CCCCAGATGCCACCACCAAGGGG No data
Right 902404952 1:16177495-16177517 TTGTCAAAGGTGCACTTTCTTGG No data
902404941_902404952 26 Left 902404941 1:16177446-16177468 CCAGATGCCACCACCAAGGGGAG No data
Right 902404952 1:16177495-16177517 TTGTCAAAGGTGCACTTTCTTGG No data
902404945_902404952 13 Left 902404945 1:16177459-16177481 CCAAGGGGAGAGGTGCCACCATG No data
Right 902404952 1:16177495-16177517 TTGTCAAAGGTGCACTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404952 Original CRISPR TTGTCAAAGGTGCACTTTCT TGG Intergenic
No off target data available for this crispr