ID: 902404954

View in Genome Browser
Species Human (GRCh38)
Location 1:16177503-16177525
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404950_902404954 -3 Left 902404950 1:16177483-16177505 CCTGGTGCACCATTGTCAAAGGT No data
Right 902404954 1:16177503-16177525 GGTGCACTTTCTTGGGTGTCCGG No data
902404947_902404954 6 Left 902404947 1:16177474-16177496 CCACCATGACCTGGTGCACCATT No data
Right 902404954 1:16177503-16177525 GGTGCACTTTCTTGGGTGTCCGG No data
902404943_902404954 27 Left 902404943 1:16177453-16177475 CCACCACCAAGGGGAGAGGTGCC No data
Right 902404954 1:16177503-16177525 GGTGCACTTTCTTGGGTGTCCGG No data
902404945_902404954 21 Left 902404945 1:16177459-16177481 CCAAGGGGAGAGGTGCCACCATG No data
Right 902404954 1:16177503-16177525 GGTGCACTTTCTTGGGTGTCCGG No data
902404944_902404954 24 Left 902404944 1:16177456-16177478 CCACCAAGGGGAGAGGTGCCACC No data
Right 902404954 1:16177503-16177525 GGTGCACTTTCTTGGGTGTCCGG No data
902404948_902404954 3 Left 902404948 1:16177477-16177499 CCATGACCTGGTGCACCATTGTC No data
Right 902404954 1:16177503-16177525 GGTGCACTTTCTTGGGTGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type