ID: 902404955

View in Genome Browser
Species Human (GRCh38)
Location 1:16177504-16177526
Sequence GTGCACTTTCTTGGGTGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404945_902404955 22 Left 902404945 1:16177459-16177481 CCAAGGGGAGAGGTGCCACCATG No data
Right 902404955 1:16177504-16177526 GTGCACTTTCTTGGGTGTCCGGG No data
902404948_902404955 4 Left 902404948 1:16177477-16177499 CCATGACCTGGTGCACCATTGTC No data
Right 902404955 1:16177504-16177526 GTGCACTTTCTTGGGTGTCCGGG No data
902404950_902404955 -2 Left 902404950 1:16177483-16177505 CCTGGTGCACCATTGTCAAAGGT No data
Right 902404955 1:16177504-16177526 GTGCACTTTCTTGGGTGTCCGGG No data
902404944_902404955 25 Left 902404944 1:16177456-16177478 CCACCAAGGGGAGAGGTGCCACC No data
Right 902404955 1:16177504-16177526 GTGCACTTTCTTGGGTGTCCGGG No data
902404943_902404955 28 Left 902404943 1:16177453-16177475 CCACCACCAAGGGGAGAGGTGCC No data
Right 902404955 1:16177504-16177526 GTGCACTTTCTTGGGTGTCCGGG No data
902404947_902404955 7 Left 902404947 1:16177474-16177496 CCACCATGACCTGGTGCACCATT No data
Right 902404955 1:16177504-16177526 GTGCACTTTCTTGGGTGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404955 Original CRISPR GTGCACTTTCTTGGGTGTCC GGG Intergenic
No off target data available for this crispr