ID: 902404956

View in Genome Browser
Species Human (GRCh38)
Location 1:16177505-16177527
Sequence TGCACTTTCTTGGGTGTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404945_902404956 23 Left 902404945 1:16177459-16177481 CCAAGGGGAGAGGTGCCACCATG No data
Right 902404956 1:16177505-16177527 TGCACTTTCTTGGGTGTCCGGGG No data
902404947_902404956 8 Left 902404947 1:16177474-16177496 CCACCATGACCTGGTGCACCATT No data
Right 902404956 1:16177505-16177527 TGCACTTTCTTGGGTGTCCGGGG No data
902404950_902404956 -1 Left 902404950 1:16177483-16177505 CCTGGTGCACCATTGTCAAAGGT No data
Right 902404956 1:16177505-16177527 TGCACTTTCTTGGGTGTCCGGGG No data
902404943_902404956 29 Left 902404943 1:16177453-16177475 CCACCACCAAGGGGAGAGGTGCC No data
Right 902404956 1:16177505-16177527 TGCACTTTCTTGGGTGTCCGGGG No data
902404948_902404956 5 Left 902404948 1:16177477-16177499 CCATGACCTGGTGCACCATTGTC No data
Right 902404956 1:16177505-16177527 TGCACTTTCTTGGGTGTCCGGGG No data
902404951_902404956 -10 Left 902404951 1:16177492-16177514 CCATTGTCAAAGGTGCACTTTCT No data
Right 902404956 1:16177505-16177527 TGCACTTTCTTGGGTGTCCGGGG No data
902404944_902404956 26 Left 902404944 1:16177456-16177478 CCACCAAGGGGAGAGGTGCCACC No data
Right 902404956 1:16177505-16177527 TGCACTTTCTTGGGTGTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404956 Original CRISPR TGCACTTTCTTGGGTGTCCG GGG Intergenic
No off target data available for this crispr