ID: 902410045

View in Genome Browser
Species Human (GRCh38)
Location 1:16207098-16207120
Sequence AGGGCGCAGAGGAGGGGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 897
Summary {0: 1, 1: 2, 2: 10, 3: 94, 4: 790}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902410045_902410053 -7 Left 902410045 1:16207098-16207120 CCCCGGCCCCTCCTCTGCGCCCT 0: 1
1: 2
2: 10
3: 94
4: 790
Right 902410053 1:16207114-16207136 GCGCCCTCGGCCTCGTCCCCCGG 0: 1
1: 0
2: 1
3: 29
4: 186
902410045_902410054 -6 Left 902410045 1:16207098-16207120 CCCCGGCCCCTCCTCTGCGCCCT 0: 1
1: 2
2: 10
3: 94
4: 790
Right 902410054 1:16207115-16207137 CGCCCTCGGCCTCGTCCCCCGGG 0: 1
1: 0
2: 2
3: 30
4: 244
902410045_902410066 30 Left 902410045 1:16207098-16207120 CCCCGGCCCCTCCTCTGCGCCCT 0: 1
1: 2
2: 10
3: 94
4: 790
Right 902410066 1:16207151-16207173 GCTGCTGCCGCCGCAGTTCGCGG 0: 1
1: 0
2: 0
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902410045 Original CRISPR AGGGCGCAGAGGAGGGGCCG GGG (reversed) Exonic
900003595 1:29430-29452 AGGGCGCAGTGGAGGGCGAGCGG - Intergenic
900023313 1:199946-199968 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
900155229 1:1201203-1201225 CGGGTGCGGAGAAGGGGCCGGGG - Intergenic
900290656 1:1922247-1922269 AGGGTGGACAGGAGGGCCCGAGG + Exonic
900420903 1:2555532-2555554 AGGGGGCAGTCGAGGGGCAGGGG + Intergenic
900507423 1:3036638-3036660 AGGGCTCAGAGGAGCCTCCGAGG - Intergenic
900584820 1:3427731-3427753 CGGGCTCAGAGGAAGGGGCGGGG + Intronic
900600441 1:3500484-3500506 TGCGCGCACAGGAGGGGGCGCGG + Intronic
900601213 1:3503463-3503485 AAGGGGCAGAGGAGGAGCAGAGG + Intronic
900601219 1:3503474-3503496 GAGGAGCAGAGGAGGGGCAGGGG + Intronic
900626659 1:3611605-3611627 AGGGGGAAGGGGCGGGGCCGAGG - Intergenic
900677198 1:3895080-3895102 AGGGAGGAGAGGTGGGGCAGTGG - Intronic
900710269 1:4109026-4109048 AGGCCGCAGAGGCTGGGCCTGGG + Intergenic
900970811 1:5991776-5991798 GGGGCGGGGAGGAGGGGCGGAGG + Intronic
900974276 1:6007518-6007540 GGGGCGCAGAGGAGGCGCGGAGG - Intronic
901050645 1:6424412-6424434 AGGTCTCTGAGGAGGTGCCGTGG - Intronic
901059197 1:6464314-6464336 TGGGAGCAGAGCAGGGGCCTGGG - Intronic
901212555 1:7534727-7534749 AGGGGGCAGAGTTGGGGCCTGGG + Intronic
901506214 1:9687579-9687601 AGGGCGTGGGGGCGGGGCCGGGG + Intronic
901773026 1:11540404-11540426 ATGGCACAGAGGAGGGGCTAAGG + Intergenic
901791344 1:11654976-11654998 GGGGCGCTGGGGAGGGGGCGCGG + Intronic
901794406 1:11672151-11672173 TGGGTGCAGAGCAGGGGCGGAGG - Intronic
901797984 1:11691636-11691658 AGGGGACAGAGGAGGGGCGGCGG - Exonic
901919427 1:12525764-12525786 AGGGAGGAGAGGAGGGGAAGTGG + Intergenic
902220012 1:14958779-14958801 AGGGACCAGGGGAGGGGCCAAGG - Intronic
902237687 1:15068268-15068290 AGGGGGGATGGGAGGGGCCGAGG + Intronic
902410045 1:16207098-16207120 AGGGCGCAGAGGAGGGGCCGGGG - Exonic
902410059 1:16207131-16207153 AGCGCGAGGAGGAGGGCCCGGGG - Exonic
902534086 1:17109041-17109063 AGAGTGCAGAGGAGAGGCCCTGG + Intronic
902721370 1:18306553-18306575 GGGGGACAGAGGAGGGGCAGGGG - Intronic
902744798 1:18466594-18466616 AGGGGACAGAGGAGGTGCTGAGG - Intergenic
903455554 1:23484391-23484413 AGGGGGCCGGCGAGGGGCCGGGG - Intronic
903499196 1:23792343-23792365 AGGGGGCAGAGGGGAGGCAGCGG - Intronic
903646103 1:24897341-24897363 CTGGAGCAGAGGAGAGGCCGGGG + Intergenic
903759102 1:25685383-25685405 GTGGAGCAGAGGAGGAGCCGGGG - Intronic
903772020 1:25770080-25770102 CTGTTGCAGAGGAGGGGCCGGGG - Intronic
903838160 1:26219363-26219385 AGGGAGCACAGCAGGGGCGGGGG - Intergenic
903859645 1:26357052-26357074 AGTGCGCAGAGGAGGATCCAAGG - Intergenic
903929710 1:26855203-26855225 AGAGCTCAGAGGAGGGGGTGTGG - Exonic
904120314 1:28193868-28193890 AGGAGGCAGAGGACGGGCCCAGG + Intronic
904349426 1:29895375-29895397 AGGGAGGAGAGGAGGTGCCTAGG + Intergenic
905253794 1:36666699-36666721 AGGGGCCAGAGTAGGGGCCCTGG - Intergenic
905308524 1:37034556-37034578 AGGGCGCAGGGGAGGGGGCTGGG - Intergenic
905847115 1:41242243-41242265 GAGGCGCGGGGGAGGGGCCGGGG - Intergenic
905977029 1:42183280-42183302 AGGGTGGAGCGGAGGGGGCGGGG + Intronic
906209099 1:44002467-44002489 AGGGGGCTGGGGAGGGGCCAGGG - Intronic
907328746 1:53657880-53657902 AGGGTGCAGAGAAGGGGCAAGGG - Intronic
907403476 1:54239823-54239845 GGGGAGCCGAGGAGGGGGCGGGG + Intronic
908429341 1:64040781-64040803 AGGGTGAAGAGGTGGGGCCTTGG - Intronic
912878894 1:113390186-113390208 AGGGCGCAGAGGAGGGGCAGGGG - Intergenic
913597705 1:120394207-120394229 GGGGGGCAGAGGAGGGGCACCGG + Intergenic
913957353 1:143318290-143318312 AGGGCCAAAAGGAGGGGCCAGGG + Intergenic
914051667 1:144143654-144143676 AGGGCCAAAAGGAGGGGCCAGGG + Intergenic
914089628 1:144485107-144485129 GGGGGGCAGAGGAGGGGCACCGG - Intergenic
914127530 1:144822887-144822909 AGGGCCAAAAGGAGGGGCCAGGG - Intergenic
914308985 1:146449109-146449131 GGGGGGCAGAGGAGGGGCACCGG + Intergenic
914386157 1:147172225-147172247 GAGGCGCAGGGGCGGGGCCGGGG - Intronic
914593128 1:149124022-149124044 GGGGGGCAGAGGAGGGGCACCGG - Intergenic
914694709 1:150067020-150067042 AGAGCGCCGAGGCGGGGGCGGGG + Intergenic
914716242 1:150257346-150257368 AGGGTGCAGGGGAGGGGTGGAGG - Exonic
914902359 1:151717485-151717507 AGGCCGCGGAGGCGGCGCCGCGG + Intronic
915332410 1:155121340-155121362 GGGGAGCAGAGGAGTGGCAGAGG - Intergenic
915443398 1:155960893-155960915 AGGGAGCAGATCAGGGGCCAGGG - Intronic
915475327 1:156149776-156149798 AGGGAGCTGAGCAGGGACCGGGG + Intronic
915541080 1:156566641-156566663 AGGAAGCAGAGGAGGGTCAGGGG - Intronic
915598555 1:156908631-156908653 TGGGGGCAGAGGCGGGGGCGTGG - Intronic
915726037 1:158018344-158018366 AGGGGGCAGGGGAAGGGCTGTGG + Intronic
916426990 1:164690140-164690162 AGAGCACAGAGGGGAGGCCGAGG - Intronic
916912681 1:169367833-169367855 AGGACGAAGAGGTGGGGCGGTGG - Exonic
917791816 1:178503988-178504010 AGGCTGCAGAGGCGGGGCCAGGG + Intergenic
917956804 1:180107806-180107828 TGGGAGCAGAGGAGGGGACAGGG - Intronic
917975746 1:180236469-180236491 TGGGAGGAGAGGAGGAGCCGGGG + Intronic
918040776 1:180912829-180912851 AGCGCGGAGAGGTGGGGCCGCGG - Intergenic
919464900 1:197915411-197915433 AGGGCCCTGAGGAGGGGCTGGGG - Intronic
919849169 1:201660856-201660878 AGGTCCCAGAGGAAGGGCCCAGG + Intronic
919914232 1:202130096-202130118 AGGGACCAGAGGTGGGGCTGGGG - Exonic
919941332 1:202288618-202288640 AGGGCGCAGAGGAGAGGTCTGGG - Intronic
920071293 1:203305166-203305188 TGGGCGAAGAGGCGAGGCCGGGG + Intergenic
920307901 1:205030816-205030838 AGGGCTCTGAGGAGGGGCTGGGG - Intergenic
920697475 1:208192226-208192248 AGGGCCCAGAGGTGGGCCAGAGG - Intronic
920965528 1:210697791-210697813 TGGAAGCAGAGGAGGGGCCTTGG - Intronic
921023749 1:211259340-211259362 AGGGGAGAGAGGCGGGGCCGGGG + Intronic
921152675 1:212414553-212414575 GGGGTGCAGAGGAGCGGCCCAGG - Intronic
922025357 1:221743475-221743497 AGGGAGAAGAGTAGGGGGCGGGG + Intergenic
922416326 1:225426748-225426770 AGGGCGCGGAGCAAGGCCCGGGG - Intronic
922729556 1:227942568-227942590 AGGGCTGAGAGGAGGGGCCCTGG - Intronic
922766403 1:228158695-228158717 AAGGCGCAGGGCGGGGGCCGCGG - Exonic
922802741 1:228371691-228371713 AGGCCTCCGAGGAGGGGCGGGGG - Exonic
923229301 1:231969487-231969509 AGGGTCAAGAGGAGGGGCCTTGG - Intronic
923494708 1:234513979-234514001 CGGGGGCAGAGGAGGGGCGATGG + Intergenic
924277207 1:242400967-242400989 AGGGCTCAGAGGAGGGGCCAGGG - Intronic
1063121345 10:3106996-3107018 AGGGGTGAGAGGAGGGGCAGGGG - Intronic
1063449977 10:6144828-6144850 ACGGCGCGGAGGAGGATCCGCGG - Intergenic
1064086540 10:12349785-12349807 GCGGCGCGGAGGAGCGGCCGGGG - Exonic
1067008765 10:42690897-42690919 TGGGGGCGCAGGAGGGGCCGGGG - Intergenic
1067095772 10:43298678-43298700 AGGAGGCCGAGGAGGGGCTGTGG - Intergenic
1067098044 10:43315197-43315219 GGGGGGCTGAGGAGGGGCTGGGG + Intergenic
1067145422 10:43690240-43690262 AGGGCGCTGCGGGGCGGCCGTGG + Intergenic
1067227471 10:44385245-44385267 AGGGAGCGGAGGAGGGGCGAAGG - Intronic
1067666410 10:48283339-48283361 AGAGCCCAGAGGAGGGGCACAGG - Intergenic
1069799812 10:71075111-71075133 AGGTGGCAGAGCTGGGGCCGGGG + Intergenic
1069820997 10:71228745-71228767 TGGGCACAGAGGAGGCCCCGTGG - Intronic
1069870029 10:71527442-71527464 AGGGCCCAGAGGAGGAGGCTGGG - Intronic
1070701001 10:78601779-78601801 AGGGGCCAGAGGAGGGGCCTTGG + Intergenic
1071450241 10:85786858-85786880 AGGGCGTGGAGGAGGGGTGGTGG + Intronic
1071527419 10:86366525-86366547 AGGGCGCAGGGGCGGGCGCGCGG - Intergenic
1073099572 10:100999725-100999747 ACCGCGCAGGGGAGGGTCCGAGG - Exonic
1073491434 10:103855578-103855600 GCGGAGCAGAGGAGGGGCGGGGG + Intergenic
1074192767 10:111151904-111151926 AGAGCGCAGAGGAAAAGCCGGGG + Intergenic
1074983362 10:118637252-118637274 AGGGAGCAGAGGAGGCCCCTAGG - Intergenic
1075257749 10:120939096-120939118 GGAAAGCAGAGGAGGGGCCGAGG - Intergenic
1075656115 10:124162339-124162361 AGGAGGCAGAGGAGGAGCCGTGG + Intergenic
1076306171 10:129467097-129467119 AGCGCGCGGGGGCGGGGCCGGGG - Intergenic
1076306202 10:129467189-129467211 GGGGCGCGGGGGCGGGGCCGAGG - Exonic
1076312489 10:129518467-129518489 AGGGAGGGGAGGAGGGGCAGGGG - Intronic
1076312502 10:129518492-129518514 AGGGAGGGGAGGAGGGGCAGGGG - Intronic
1076312515 10:129518517-129518539 AGGGAGGGGAGGAGGGGCAGGGG - Intronic
1076424074 10:130355039-130355061 AGGGCACAGAGGAGGTGCCCAGG + Intergenic
1076504313 10:130961978-130962000 AGGGCAGATAGGAGGGGCCAAGG - Intergenic
1076546886 10:131251307-131251329 TGGGCTGGGAGGAGGGGCCGGGG - Intronic
1076778147 10:132709445-132709467 AGGGAGCTGAGAAGGAGCCGCGG + Intronic
1076828250 10:132981321-132981343 AGAGCCCAGAGGAGGGGCTCAGG + Intergenic
1076871395 10:133196718-133196740 AGGGAGGACAGGAGTGGCCGGGG + Intronic
1076884830 10:133257556-133257578 CTGGGGCAGAGGAGGGGCGGGGG - Intergenic
1076986021 11:236454-236476 GGGGCGCGGAGGCGGGACCGGGG - Intronic
1077027630 11:448307-448329 AGGGTGCAGAGGCCGGGGCGGGG - Intronic
1077048150 11:555198-555220 AGAGCGGAGGGGAGGGGACGAGG + Intronic
1077090747 11:777259-777281 GGGGCGCCGGGCAGGGGCCGGGG - Intronic
1077108156 11:850748-850770 CGGGCGCAGAGGAGGCACCGGGG - Intronic
1077137171 11:1006262-1006284 TGGGTGCGCAGGAGGGGCCGAGG + Intronic
1077141258 11:1025926-1025948 AGGGCGCTGAGGAGGAGCCCTGG + Intronic
1077146332 11:1047897-1047919 AGAGCTCAGATGAGAGGCCGGGG - Intergenic
1077289274 11:1781427-1781449 AGGCCGCAGAGCTGGGGACGTGG - Intergenic
1077324876 11:1959367-1959389 AGGGCCCACAGGAAGGGCCCTGG + Intronic
1077325196 11:1960752-1960774 ATGGGGCAGAGGAGGAGCCCAGG - Intronic
1077433093 11:2525761-2525783 AGGGAGCAGAGGAAGGGTCATGG + Intronic
1077497343 11:2892593-2892615 AGGGAGGGGAGGAGGGGCAGGGG - Intronic
1077602020 11:3580869-3580891 GGGGCGCAGGGTAGGGGCGGCGG - Intergenic
1078233320 11:9461516-9461538 AGGCCGCAGCGGGGGCGCCGGGG + Intronic
1078266381 11:9758696-9758718 AGGGGCCCGAGGAGGAGCCGGGG - Intergenic
1079005639 11:16789637-16789659 AGGGAGCTCAGGAGGGGCTGAGG + Intronic
1079250148 11:18781146-18781168 AGGGGGCCGGGGCGGGGCCGGGG - Intronic
1079336830 11:19577477-19577499 AGGGGGCCCAGGAGGAGCCGGGG - Intronic
1081866095 11:46361571-46361593 AGGGGGCAGAGGAGCAGCCACGG + Intronic
1081992751 11:47346541-47346563 AGGGAGCTGAAGAGGGGCTGGGG + Intronic
1083625493 11:64069972-64069994 AGGGGGCAGAGCAGGGGGCCAGG + Intronic
1083840450 11:65301435-65301457 GGGGCTCAGGGGAGGGGCCTGGG + Intronic
1084104918 11:66975062-66975084 AGGGGGGAGAGGAGGGGAGGGGG + Intergenic
1084455819 11:69267705-69267727 AGGCCCCAGAGGAGGGGCCCAGG + Intergenic
1084470971 11:69358750-69358772 AGGGTGCAGAGGGTGGGCTGTGG + Intronic
1084491919 11:69483603-69483625 TGGGCTCAGAGGAGGGGAAGAGG + Intergenic
1084493527 11:69490889-69490911 AGGGGGCGGTGGAGGGGCAGGGG - Intergenic
1084632745 11:70365270-70365292 CAGGCACAGAGAAGGGGCCGAGG - Intronic
1084652159 11:70495662-70495684 TGGGGTCAGAGGAGGGGCCCGGG - Intronic
1084687286 11:70703984-70704006 CGGGCTCAGGGGAGGGGCCTGGG + Intronic
1084786988 11:71448299-71448321 TGGGCGCAGGTGAGGGGCCGAGG - Exonic
1084960366 11:72713203-72713225 AGGTCCCAGAGGAGGGGCCGGGG - Exonic
1085423238 11:76381175-76381197 AAGGCGGAAAGGAGGGGCGGGGG - Intergenic
1088256928 11:107911764-107911786 AGGGGGAGGAGGAGGGGCAGGGG - Intronic
1088653377 11:111977282-111977304 AGGGAGCAGAGGGTGGGGCGGGG + Intronic
1088823471 11:113475270-113475292 GGGGAGCAGTGGACGGGCCGCGG + Exonic
1089070841 11:115698344-115698366 AGGGCCTAGAGGAGGGGGTGAGG - Intergenic
1089196435 11:116696357-116696379 AGGGAGCAGTGGAGAGGGCGGGG - Intergenic
1089284065 11:117394485-117394507 AGGGAGCAGGTGAGGGGCCTGGG + Exonic
1089525775 11:119095501-119095523 AGGGCGCAGAGGTGTGTCCTGGG - Intergenic
1089781274 11:120874829-120874851 AGGGCCTGGAGGAGGGGCTGAGG + Intronic
1089849244 11:121482198-121482220 AAGGAGCAGAGCAGGGGCCGTGG + Intronic
1090273644 11:125404871-125404893 AGAGTCCAGAGGACGGGCCGCGG + Intronic
1090502944 11:127279668-127279690 AGGGGGAAGAGGAGGGGGAGGGG - Intergenic
1090985223 11:131760667-131760689 TGGGGGCCGGGGAGGGGCCGGGG + Intronic
1091332561 11:134741630-134741652 GGGGAGGAGAGGAGGGGGCGAGG + Intergenic
1091335830 11:134764986-134765008 AGGGAGGAGAAGAGGGGCTGTGG - Intergenic
1202807857 11_KI270721v1_random:14544-14566 AGGGCCCACAGGAAGGGCCCTGG + Intergenic
1202808177 11_KI270721v1_random:15931-15953 ATGGGGCAGAGGAGGAGCCCAGG - Intergenic
1091377012 12:31484-31506 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1091398892 12:171041-171063 GGGGCACAGGGGAGGGGCAGGGG + Intronic
1091616272 12:2053205-2053227 GAGGCGGAGAGGAGGGGCGGGGG - Intronic
1091797445 12:3305413-3305435 AGGGAGCAGGGGAGGGGGGGAGG - Intergenic
1091950023 12:4585005-4585027 AGACGGCAGAGGAGGGGCCCTGG + Intronic
1092239695 12:6829110-6829132 AGATCGCAGAGGAGCAGCCGAGG + Intronic
1092258926 12:6942078-6942100 ACGGGGCAGGGGAGGGGCGGCGG - Exonic
1092290837 12:7158672-7158694 AGGTCACGGAGGAGGGGCCGGGG - Exonic
1092428163 12:8390212-8390234 GGGGCGCAGGGTAGGGGCGGCGG - Intergenic
1092487354 12:8914429-8914451 AGGGCGCCGAGGGGAGGCGGAGG + Intronic
1092917437 12:13201627-13201649 ATGGGGCAGAGGAGGCTCCGTGG - Intronic
1093894757 12:24563125-24563147 TGGGCGCAGAGCAGCGGCTGAGG - Intergenic
1094293829 12:28881410-28881432 GGGGGGCAGCGCAGGGGCCGGGG - Intergenic
1094294569 12:28889862-28889884 AGGGGGCAGGGGAGGTGCTGGGG - Intergenic
1095102988 12:38202439-38202461 AGGGAGCTGAGCTGGGGCCGTGG + Intergenic
1096411003 12:51377161-51377183 GGGGCCCAGAGGAGGGGGCCGGG - Intronic
1096594282 12:52684678-52684700 AGGCAGCAGAGGAGGGGCCAAGG + Intergenic
1096634318 12:52948967-52948989 AGGGCGCGGGGGTGGGGCCCGGG + Exonic
1096675148 12:53222005-53222027 CGGGCGCGGGGGAGGGGCGGGGG + Intronic
1096677234 12:53232321-53232343 AGGGCACAGAGGAGGGAGCCGGG - Intronic
1096749702 12:53751211-53751233 AGGGCTCAGAGGAGGGGCGGCGG - Intergenic
1096848013 12:54418596-54418618 GGGGCGCAGAGGGGGCGCAGAGG - Intronic
1097046128 12:56189126-56189148 AGGGCGCAGCAGTGGGGGCGGGG + Intronic
1097046172 12:56189236-56189258 AGGCCGCGGGGGAGGGGCTGGGG + Intronic
1097190264 12:57216403-57216425 CAGGCGCAGGGCAGGGGCCGAGG - Intergenic
1097251305 12:57633519-57633541 AGGGCGGGGAGGAGGGGGAGAGG - Intergenic
1100362245 12:93889584-93889606 GGGTCTCAGAGGAAGGGCCGTGG + Intronic
1101371810 12:104137822-104137844 CCGGGGCCGAGGAGGGGCCGCGG - Intronic
1101942591 12:109111113-109111135 AGGGCGGGGAGGAGGGGCAAGGG - Intergenic
1102434634 12:112911276-112911298 TGGGAGCAGAGGAGGGGTGGGGG + Intronic
1102453280 12:113056840-113056862 CGGGCGCGGAGGCGGGACCGCGG + Intronic
1102471389 12:113161781-113161803 GGGGCGGGGAGGAGGGGGCGGGG - Intronic
1102520033 12:113472317-113472339 AGGGCGCAGAGGGGGCGCGGGGG - Intergenic
1102950294 12:117026583-117026605 GGGGTGCACAGGAGGGGACGAGG - Intronic
1103324422 12:120110965-120110987 AGGAAGCAGAGGAGGCGGCGAGG - Intronic
1104008882 12:124915031-124915053 GGGGCTGAGGGGAGGGGCCGCGG - Exonic
1104049596 12:125186611-125186633 AGCGCGCAGAGGCGCAGCCGAGG + Intergenic
1104449731 12:128859394-128859416 GGGGCACAGAGGATGTGCCGAGG + Intronic
1104641666 12:130471133-130471155 AGGCCCTGGAGGAGGGGCCGGGG + Intronic
1105205712 13:18221815-18221837 GGGGTGCAGAGGAGGGGCTGTGG - Intergenic
1105843113 13:24272530-24272552 AGGGGGCAGGGGAGGGGTTGTGG + Intronic
1106409766 13:29503149-29503171 AGGGCCCCGAGGAGGAGCCGCGG - Exonic
1107851752 13:44577743-44577765 ACGCGGCAGAGGAGGGGGCGCGG + Intergenic
1108747279 13:53408801-53408823 AGGGCCCAGAAGTGGGGTCGTGG + Intergenic
1110775658 13:79405844-79405866 GGCGCGCGGAGGAGGGGGCGGGG - Exonic
1111950868 13:94708100-94708122 AGGGCGTAGAGAAAGGCCCGGGG - Intergenic
1113464282 13:110503209-110503231 AGGGACCAAAGGATGGGCCGGGG + Exonic
1113706232 13:112434517-112434539 AGCGCACAGAGGAGGAGCCAAGG + Exonic
1113768442 13:112894614-112894636 AGGACGCTGGGCAGGGGCCGCGG - Intronic
1113775669 13:112943605-112943627 CAGGCGCAGAGGAGGCGCGGGGG + Intronic
1113794272 13:113047903-113047925 AGGCGTCAGCGGAGGGGCCGGGG - Intronic
1114259380 14:21025856-21025878 GGGGCGCGGGGGAGGGGCCGGGG + Intronic
1114265704 14:21071407-21071429 AGGGAGTGGAGGAGGGGCAGGGG + Intronic
1114487541 14:23071781-23071803 AGGGGGCAGGGGAGGGGGCTGGG + Intronic
1114524491 14:23359511-23359533 AGGGCACTGGGGAGGGGCTGGGG + Exonic
1114653091 14:24299217-24299239 AGGGCTAAGAGGAGGAGCCAAGG + Intronic
1114668952 14:24398859-24398881 GGGGCGCGGAGGAGAGGGCGGGG - Exonic
1117974186 14:61281280-61281302 CGGAGGCAGAGGAGGGGCCCGGG - Exonic
1121104378 14:91271065-91271087 GGGGCGCAGAGGGGGGGTGGAGG + Intergenic
1122125107 14:99574633-99574655 AGAGCGGAGAGGAGAGGCAGTGG + Intronic
1122324517 14:100874597-100874619 AGGGTGCAGAGGAGGGTCCGGGG - Intergenic
1122602959 14:102930340-102930362 GGGGCGCGGAGGTGGGGCTGGGG + Intronic
1122776654 14:104119874-104119896 AGGCCGGAGTGGAGGGGCTGGGG - Intergenic
1122897755 14:104768895-104768917 AGGGCCCAGAGTTGGGGCCAAGG - Intergenic
1122909401 14:104819717-104819739 AGGGAGTAGACCAGGGGCCGAGG + Intergenic
1122937540 14:104967013-104967035 TGGGGGCAGAGGAGGGTCCCTGG + Intronic
1122947839 14:105021290-105021312 CGGGCGCAGGGGCGGGGGCGGGG - Intergenic
1122972677 14:105158752-105158774 GGGGCCCAGAGGAGGGGGCTGGG + Intronic
1202931017 14_KI270725v1_random:31755-31777 AGGGCCAAAAGGAGGGGCCAGGG - Intergenic
1123421413 15:20139923-20139945 AGGGCCAAAAGGAGGGGCCAGGG + Intergenic
1123477399 15:20599297-20599319 TGGGGGCAGGGGAGGGGCAGTGG + Intergenic
1123530639 15:21146463-21146485 AGGGCCAAAAGGAGGGGCCAGGG + Intergenic
1123640617 15:22401085-22401107 TGGGGGCAGGGGAGGGGCAGTGG - Intergenic
1124983495 15:34584120-34584142 AGGGCGCAGCGCCGCGGCCGGGG - Intronic
1125404419 15:39337806-39337828 AGGCCGCGGAGAAGGGGCAGCGG - Intergenic
1126599999 15:50418733-50418755 AGGGAGGAGAGGCGGGGCCTGGG - Intergenic
1126696863 15:51333713-51333735 AGGGACCAGAGGAGTGGCCCCGG - Intronic
1126766943 15:52019208-52019230 AGGGCGAGGAAGAGGGGGCGGGG - Exonic
1127323809 15:57874478-57874500 TGGGTGCAGAGGAGGGGGCTGGG - Intergenic
1127374717 15:58373920-58373942 AGGGCAGAGAGGAGGGGAAGAGG + Intronic
1127885964 15:63201272-63201294 AGTGTGCAGAGGAGAGGTCGAGG + Intronic
1127914663 15:63445540-63445562 TGGGCACAGAGGAGGGAACGGGG - Intergenic
1128052736 15:64677912-64677934 TGGGTGCAGAGGTGGGGGCGGGG + Intronic
1128078681 15:64843422-64843444 TGGGAGCAGGGGAGGGGCCCTGG - Intronic
1128087712 15:64897377-64897399 AGGGCCCTGAGGAGGGGGCGTGG + Intronic
1128221752 15:65974262-65974284 GGGGCTAAGAGGAGGGGCTGAGG + Intronic
1128861755 15:71080134-71080156 AGGGCGGAGAGGAGAGGACCAGG + Intergenic
1129016596 15:72474437-72474459 AGGGCGCGGAGGAGGGAGGGAGG - Exonic
1129244511 15:74271354-74271376 AGGAGCCAGTGGAGGGGCCGAGG + Intronic
1129244619 15:74271836-74271858 AGAGGGCAGAGGAGGGGGTGAGG + Intronic
1129250905 15:74308505-74308527 AGGGCGGAGTCGAGGGGGCGGGG + Intronic
1129457890 15:75685348-75685370 ACGGAGCAGTGGAGGGGCCAGGG + Exonic
1129822881 15:78616686-78616708 ATGGAGCAGAGGAGGGCCCGGGG - Intronic
1130663479 15:85850112-85850134 TGGGGGAAGAGGAGGGGCCCAGG - Intergenic
1131069510 15:89456989-89457011 AGGGCTCAGAGAAGGGGATGTGG - Intergenic
1131226040 15:90624943-90624965 AGGGGGAAGAGAAGGGGACGTGG + Intronic
1131510106 15:93045035-93045057 AGGGCGCCCAGGAGGGGCCGGGG + Exonic
1132449908 15:101961510-101961532 AGGGCGCAGCGGAGGGCGAGCGG + Intergenic
1132546250 16:534719-534741 AGGGCGCAGTGGGGTTGCCGTGG + Intronic
1132596329 16:752186-752208 AGGGAGAAAAGCAGGGGCCGAGG - Intronic
1132632194 16:923618-923640 AGGACGTGGAGGAGGGGCTGTGG + Intronic
1132651724 16:1024235-1024257 AGGGAGCAAAGAAGGGGCAGCGG - Intergenic
1132671613 16:1104252-1104274 GGGGTGCAGAGGAGGGGCCTGGG + Intergenic
1132703088 16:1230228-1230250 AGGGGGCGGAGGAGGGGCGCTGG + Intergenic
1132705233 16:1240640-1240662 AGGGGGCGGAGGAGGGGCGCTGG - Intergenic
1132708363 16:1256003-1256025 AGGGGGCGGAGGAGGGGCGCTGG - Intergenic
1132730000 16:1356492-1356514 CAGGCGGAGGGGAGGGGCCGTGG + Intronic
1133046189 16:3089605-3089627 TGGGTGCAGTGGTGGGGCCGAGG + Exonic
1133063386 16:3189457-3189479 GCGTCGCGGAGGAGGGGCCGGGG + Intergenic
1133220026 16:4315941-4315963 AGGGCGAGGAGGAGGGGCGCGGG - Intronic
1134290530 16:12900789-12900811 GGAGCGCAGAGGCGGCGCCGCGG + Intergenic
1134581830 16:15377582-15377604 AGGGCGGAGGGAAGGGGACGGGG + Intronic
1135070652 16:19348835-19348857 AGGACTCTGAGGAGGGGCAGTGG - Intergenic
1136454040 16:30370325-30370347 GGCGCGCAGAGGCGGGGCAGGGG + Intergenic
1136567643 16:31079737-31079759 ACATGGCAGAGGAGGGGCCGGGG + Exonic
1137978872 16:53053428-53053450 GGGGAGCAGAGTGGGGGCCGGGG + Intergenic
1138179134 16:54930635-54930657 AGGGGTGAGAGGGGGGGCCGCGG + Intergenic
1138179221 16:54930990-54931012 GGCGCGCAGAGGAGCGGGCGCGG + Exonic
1138250937 16:55501494-55501516 AGGGCTCAGTGGAGGTGCCTTGG + Intronic
1138417831 16:56881354-56881376 AGGAAGCAGAGACGGGGCCGGGG - Intronic
1138530209 16:57630715-57630737 AGGGCCCAGAGAAGGGGAAGAGG + Intronic
1138677985 16:58665697-58665719 AGGGGGCAGCTGAGGGGCTGAGG + Exonic
1141240957 16:82264674-82264696 AGGGAGCAGAGGAGGGGAAAGGG - Intergenic
1141705285 16:85661400-85661422 AGAAAGCAGAGGAGGGGCCACGG + Exonic
1142065443 16:88059784-88059806 AGGGAGCAGAGGAGGGGGCATGG - Intronic
1142109391 16:88323217-88323239 AGAGCTCCGAGGAGGGGCCCCGG + Intergenic
1142147824 16:88499869-88499891 ATGGGGCCGAGGAGGGGCCGGGG - Intronic
1142155467 16:88530973-88530995 AGGCCGCAGAGGGGAGGGCGCGG + Intronic
1142156329 16:88534292-88534314 AGCGCGCAGGGGCGAGGCCGGGG - Exonic
1142191749 16:88721338-88721360 AGGGAGCCGAGGAGGGGCCAGGG - Exonic
1142240298 16:88941686-88941708 CGGGCGCCGTGGAGGGGGCGCGG + Intronic
1142427217 16:90007620-90007642 AGTGAGCTGAGGAGGGGCCCGGG + Intronic
1142582045 17:949012-949034 AGGGGGGAGAGGAGGAGCCCGGG - Intronic
1142596488 17:1032146-1032168 GGGGCCAAGCGGAGGGGCCGGGG + Intronic
1142795532 17:2303949-2303971 CGTGCGCAGAGGTGCGGCCGGGG + Exonic
1142836767 17:2593535-2593557 CGGGAGCGGAGGAGGGGCTGCGG - Intronic
1143109027 17:4543291-4543313 AGGCCACAGAGGAGGGCCCAGGG + Intronic
1143112937 17:4562922-4562944 AGGGCTCAGAGTAGGGGTGGGGG + Intergenic
1143155264 17:4832791-4832813 GGGGGGCAGAGGAGGGGCACCGG - Intergenic
1143391311 17:6560885-6560907 AGGAGGAAGAGGAGGGGCGGAGG - Intergenic
1143471129 17:7176955-7176977 AGGGCGCTGGGGCGGGGCTGGGG - Intronic
1143505334 17:7361476-7361498 AGGGTTCAGAGAAGGGGCTGGGG + Intergenic
1143751900 17:9034238-9034260 AGGGCTCAGAGGAGGGGTACAGG + Intronic
1144344778 17:14339925-14339947 TGTGCCCAGAGGAGGGGCAGAGG + Intronic
1144778036 17:17794731-17794753 AGGGCGCTGAGCAGCAGCCGCGG - Exonic
1144874795 17:18391835-18391857 AGGGGGCAGAGGAGGAGCATGGG - Intergenic
1144891091 17:18494751-18494773 AGGTCAGAGAGGAGGGGCTGAGG - Exonic
1145141132 17:20449567-20449589 AGGTCAGAGAGGAGGGGCTGAGG + Intronic
1145157430 17:20552586-20552608 AGGGGGCAGAGGAGGAGCATGGG + Intergenic
1145252518 17:21304313-21304335 AGGGGGCACAGGAGGGGTCTTGG + Intronic
1145388332 17:22435313-22435335 AGGGAGGAGGGGAGGGGTCGAGG - Intergenic
1145794795 17:27649366-27649388 AGGTCAGAGAGGAGGGGCTGAGG - Exonic
1145799842 17:27675933-27675955 AGGGGGCAGAGGAGGAGCATGGG + Intergenic
1145826207 17:27878941-27878963 CAGGAGCAGAGGAGGGGGCGGGG + Exonic
1145935449 17:28712140-28712162 AGCGGGCAGAGGCGGGGCTGCGG - Intergenic
1146159362 17:30551665-30551687 AGGGGGCAGAGGAGGAGCATGGG - Intergenic
1146212416 17:30952865-30952887 AGGCCACAGAGAAGGGGCTGGGG - Intronic
1146379901 17:32320902-32320924 AGGGCCCTGAGCAGGGGCTGAGG - Intronic
1146647474 17:34584698-34584720 AGAGGGCAGAAGAGGGGCAGGGG + Intronic
1146845217 17:36178149-36178171 AGGGGGCAGAGGAGGAGCATGGG + Intronic
1146873433 17:36389992-36390014 AGGGGGCAGAGGAGGAGCATGGG + Intronic
1146880792 17:36441080-36441102 AGGGGGCAGAGGAGGAGCATGGG + Intergenic
1146928447 17:36761572-36761594 AGGGTGGGGAGGAGGGGACGAGG - Intergenic
1147065957 17:37922881-37922903 AGGGGGCAGAGGAGGAGCATGGG - Intergenic
1147184358 17:38705517-38705539 AGGGAGAGGAGGAGGGGGCGAGG + Intergenic
1147187443 17:38720315-38720337 AGGGGGCGGAGGCGGGGCCAGGG - Intronic
1147250254 17:39149046-39149068 GGGGTGCAGAGCAGGGGCCCAGG - Intronic
1147383818 17:40070608-40070630 AGGGCGATGCTGAGGGGCCGGGG - Intronic
1147538139 17:41334189-41334211 AGGGGGCAGAGGAGGAGCATGGG + Intergenic
1147752552 17:42745055-42745077 ACGGCGCAGGGGTGGGGCCGCGG - Intergenic
1147766910 17:42843138-42843160 AGGGTGAGGAGGAGGGGCAGTGG - Exonic
1147770455 17:42864446-42864468 CGGGGACAGAGGAGGGGCCTAGG + Intergenic
1148048615 17:44758776-44758798 AGGTGGCCGAGGAGAGGCCGCGG + Intergenic
1148437427 17:47694698-47694720 TGGGCGCAGAGGGGCGGGCGGGG + Intronic
1148904862 17:50905523-50905545 AGGGAGCAGAGGAGGTTCCAGGG - Intergenic
1148913521 17:50955907-50955929 AGGGAGAAAAGGAGGGGCTGAGG - Intergenic
1149263166 17:54900769-54900791 CGGGCGAAGAGGAGGAGCCAAGG + Exonic
1150136125 17:62696292-62696314 AGGGAGCAGCGGAGGGACGGAGG + Intergenic
1150489033 17:65561754-65561776 AGGGGGCGGAGGAGAGGCCGGGG - Intronic
1151138685 17:71971515-71971537 AGGGAGCAGAGGATGGGGAGGGG + Intergenic
1151383814 17:73743175-73743197 AGGAGGCGGAGGTGGGGCCGCGG - Intergenic
1151578383 17:74963990-74964012 AGGCTGCAGAGGAGGGTCAGGGG + Intronic
1151717152 17:75836744-75836766 AGGGCTCAGGGAAGGGGCAGGGG - Intronic
1151822808 17:76506291-76506313 AGGGAGCAGGGGAGTGGCTGGGG + Intergenic
1151852815 17:76701071-76701093 AGGGCTGTGAGCAGGGGCCGGGG + Intronic
1152218573 17:79048585-79048607 TGGGGTCAGGGGAGGGGCCGGGG + Exonic
1152362641 17:79839628-79839650 AGGGCGCCGGGGAGGTGCAGGGG + Intergenic
1152380711 17:79941122-79941144 CGGGGGGTGAGGAGGGGCCGGGG + Intronic
1152624577 17:81382354-81382376 GGGGACCAGAGGAGGGGACGTGG - Intergenic
1152625697 17:81387038-81387060 GGGGCGCGGAGGGAGGGCCGAGG + Intergenic
1152704973 17:81838754-81838776 AGGGGGCAGGGGAGGGGACAGGG - Intergenic
1152718316 17:81910503-81910525 AGGGGGCAGAGGCTGGGCCAGGG + Intronic
1152853056 17:82648733-82648755 GGGGCGGGGAGGAGGGGGCGGGG + Intergenic
1153290704 18:3499116-3499138 AGCCGGCAGAGGAGCGGCCGGGG + Exonic
1154132896 18:11751659-11751681 GCGGCGCAGCGGAGGGGCTGCGG + Intronic
1154162468 18:11990408-11990430 AGAGAGAAGAGGAGGGGTCGGGG + Intronic
1154954818 18:21242880-21242902 AGGGCGCCGCGGAGGTGGCGGGG + Intronic
1155746561 18:29361978-29362000 AACGCGCAGGGGAGGGGCTGGGG - Intergenic
1156262638 18:35459298-35459320 AGAGGGCAGAGGAGGGGACGGGG + Intronic
1156450882 18:37266002-37266024 AGGGAGCAGAGGAGGAGAGGTGG - Intronic
1157297514 18:46456892-46456914 AGGGCGGGAAGGAGGGGCCCAGG + Exonic
1157603597 18:48911379-48911401 AGGGCTCAGAGCAAGGGCTGTGG + Intergenic
1157867293 18:51197495-51197517 AGGGCGGGGTGGAGGGGCAGGGG + Intronic
1159357648 18:67358169-67358191 AGGGGGGAGAGGAGGGGAGGGGG + Intergenic
1160021246 18:75183605-75183627 GGGGCACAAAGGAGGGGCAGAGG - Intergenic
1160058713 18:75510158-75510180 AGGTGGCAGAGGAGAGGCCCTGG - Intergenic
1160499105 18:79393826-79393848 TGGCCGCAGAGGCCGGGCCGGGG + Intergenic
1160499321 18:79394482-79394504 CGGGAGGGGAGGAGGGGCCGCGG - Intergenic
1160543501 18:79638232-79638254 CGGGCGGAGAGCAGGGCCCGAGG - Intergenic
1160560223 18:79751226-79751248 TGGGCGCAGAGGACAGGCCGGGG + Intronic
1160635348 19:71037-71059 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1160691508 19:462379-462401 AGGGCGCAGAGAGGGGGTGGTGG - Intergenic
1160771197 19:831945-831967 CGGGGGCAGGGGCGGGGCCGTGG - Exonic
1160786120 19:900852-900874 AAGGCGCGGAGGAGGGGCCCTGG - Exonic
1160793057 19:931858-931880 AGGGTGCCGTGGAGGGGCAGTGG + Intronic
1161063689 19:2227501-2227523 AGGGCGGAGAGGAGCCGCCGGGG + Intronic
1161241300 19:3225200-3225222 AGGGGGCGGAGGAGGGGAGGGGG - Intronic
1161313977 19:3609308-3609330 AGGGAGCAGAGCTGGGGCCCTGG - Intergenic
1161332943 19:3696910-3696932 AGGGAGCAGAGGAAGAGCAGGGG + Intronic
1161476676 19:4489903-4489925 AGGGGCCAGAGGAGGGGATGCGG - Intronic
1161750491 19:6092707-6092729 ACGTTCCAGAGGAGGGGCCGGGG + Intronic
1161865237 19:6828369-6828391 AGGGAGAAGGGGAGGGGCCCAGG + Intronic
1162079441 19:8209550-8209572 TGGCCGCGGAGGCGGGGCCGGGG - Intronic
1162497966 19:11034079-11034101 GTGCCGCTGAGGAGGGGCCGGGG - Intronic
1162789549 19:13055756-13055778 AGGACCCAGAGGAGAGGCTGGGG - Intronic
1162798394 19:13098245-13098267 GGGGAGCAGAGGCGGGGCTGGGG - Intronic
1163144215 19:15369811-15369833 AGGGCACAGAAGATGGGCTGGGG + Intronic
1163386174 19:17001793-17001815 GGAGGGCAGAGGAGGGGCCCAGG + Intronic
1163426856 19:17245068-17245090 CGGGCGACGAGGAGCGGCCGGGG - Exonic
1163522062 19:17797359-17797381 AGTCCCCAGAGGAGGGGCCCAGG + Intronic
1163573902 19:18099323-18099345 TGGGCGGAAAGGAGGGGGCGGGG + Intronic
1163635918 19:18437253-18437275 AGGTCTCAGGGGAGGGGCCTGGG - Intronic
1163697025 19:18769141-18769163 AGGGCGCAGGCCGGGGGCCGGGG + Intronic
1163776218 19:19219323-19219345 TGGGGGCAAAGGAGGGGCCGGGG + Intronic
1163783177 19:19261192-19261214 AGGGTTCAGAGGAGGGGCCTAGG + Intronic
1164156777 19:22602051-22602073 AGGGGGCAAAGGTGGGGCAGGGG - Intergenic
1165058139 19:33191871-33191893 AGGGAGCAGTGGTGGGGCAGAGG - Intronic
1165072634 19:33264444-33264466 GGGGCACTGAGGAGGGGTCGAGG - Intergenic
1165199850 19:34134712-34134734 GGGGCGCGCAGGAGGGTCCGGGG - Intergenic
1165658303 19:37551897-37551919 AGGGCGCATAAGAGAGCCCGCGG - Intronic
1165720692 19:38077519-38077541 ATGGAGCAGAGGAAGGGCCTGGG + Intronic
1165744843 19:38224351-38224373 ACGGCGCGGAGGAGGGGCCCGGG + Intronic
1165772066 19:38385804-38385826 TGGGGGCAGAGCAGGGGCTGCGG + Exonic
1165774303 19:38395743-38395765 CAGGCGCAGAGGATGGGCCCGGG - Exonic
1165784123 19:38451194-38451216 AGGGCGTAGAGACGGGGCCTGGG + Intronic
1165855679 19:38878290-38878312 AGGGGGAAGAGGCGGGGCTGGGG + Intergenic
1165936136 19:39390193-39390215 TGGGAGCAGAGGTGGGGCAGCGG - Intronic
1166001032 19:39877630-39877652 GGGGAGCAGAGGTGGGGCGGGGG - Intronic
1166003815 19:39893889-39893911 GGGGAGCAGAGGCGGGGCTGGGG - Intronic
1166105709 19:40597155-40597177 CGGGGGCAGGGGCGGGGCCGGGG + Intronic
1166211021 19:41306622-41306644 CGGGGGCAGAGGAGGGGCCGAGG - Exonic
1166312509 19:41970594-41970616 TGAGGGCAGAGGAGGGGCAGAGG - Intronic
1166751708 19:45166966-45166988 AGGGGGCAGAGGAGAGGGTGAGG - Intronic
1166777810 19:45323252-45323274 AGGGGGCACAGGGGGAGCCGAGG - Intergenic
1166778425 19:45326500-45326522 AGTGGGCAGTGGAGGGGCAGAGG - Intergenic
1166843420 19:45712431-45712453 AGGGGGCGGAGGGGGCGCCGGGG + Exonic
1166982567 19:46639652-46639674 CCGGCGCCGAGGAGGGGCCTGGG + Intergenic
1167268251 19:48493883-48493905 CGGGCGCGGCGGCGGGGCCGCGG - Exonic
1167281641 19:48572696-48572718 TGGGAGCAGAGGAGGGGCAGCGG + Intronic
1167368100 19:49065103-49065125 GGGCGGCAGAGGAGGGGCCGGGG + Intergenic
1167380199 19:49133964-49133986 GGGGCTTAGAGGAAGGGCCGTGG + Intronic
1167440634 19:49506772-49506794 AGGGTGGAGAGGAGGGGCAGCGG + Intergenic
1167465856 19:49650950-49650972 AGGATGCAGAGGAGGGGGCAGGG - Exonic
1167472041 19:49680701-49680723 AGTGCGCAGCAGAGGGGCAGGGG - Intronic
1167486653 19:49766943-49766965 CGGGCGGAGGGGAGGGGCAGGGG + Intergenic
1167614701 19:50526061-50526083 AGGGCCCAGGGGAGGGACAGGGG - Intronic
1167792095 19:51689281-51689303 TGGGCGGTGGGGAGGGGCCGGGG + Intergenic
1168150949 19:54448445-54448467 AGGGCGCAGGGGAGGGGGCACGG - Intergenic
1168301706 19:55408401-55408423 ACGGCTCAAAGGAGGGGGCGCGG - Intergenic
1168330135 19:55563349-55563371 AGGCCGCAGAGGAGAGCGCGTGG + Intergenic
1168389338 19:55993434-55993456 AGGGGGGAGAGGAGGGGGAGAGG - Intergenic
1168389366 19:55993492-55993514 AGGGGGGAGAGGAGGGGAGGGGG - Intergenic
1202691063 1_KI270712v1_random:96078-96100 AGGGCCAAAAGGAGGGGCCAGGG + Intergenic
924988164 2:289035-289057 AGGGGGAAGAGGAGGAGACGGGG - Intergenic
925022209 2:580218-580240 AGGGCGCTGAGTGGGGGCAGTGG + Intergenic
925379677 2:3416563-3416585 AGGGCACAGTGAAGGGGCAGGGG - Intronic
925379694 2:3416610-3416632 AGGGCACAGTGAAGGGGCAGGGG - Intronic
925379702 2:3416633-3416655 AGGGCACAGTGAAGGGGCAGGGG - Intronic
925379711 2:3416657-3416679 AGGGCACAGTGAAGGGGCAGGGG - Intronic
925379727 2:3416703-3416725 AGGGCACAGTGAAGGGGCAGGGG - Intronic
925379736 2:3416727-3416749 AGGGCACAGTGAAGGGGCAGGGG - Intronic
925379754 2:3416773-3416795 AGGGCACAGTGAAGGGGCAGGGG - Intronic
925379763 2:3416797-3416819 AGGGCACAGTGAAGGGGCAGGGG - Intronic
925379781 2:3416843-3416865 AGGGCACAGTGAAGGGGCAGGGG - Intronic
925379790 2:3416867-3416889 AGGGCACAGTGAAGGGGCAGGGG - Intronic
925379799 2:3416891-3416913 AGGGCACAGTGAAGGGGCAGGGG - Intronic
925379808 2:3416915-3416937 AGGGCACAGTGAAGGGGCAGGGG - Intronic
925405866 2:3605291-3605313 TGGGTGCCGAGGAGGGGGCGGGG + Intronic
925405878 2:3605322-3605344 TGGGTGCCGAGGAGGGGGCGGGG + Intronic
925405890 2:3605353-3605375 TGGGTGCCGAGGAGGGGGCGGGG + Intronic
925599674 2:5595483-5595505 TGGGGGCAGAGGAGAGGCAGTGG + Intergenic
925616511 2:5748897-5748919 AGGGAGCAGGGGATGGGCTGGGG - Intergenic
925959857 2:9004059-9004081 AGGGCGCCGAGGCGCGGCCCGGG + Intergenic
926055661 2:9772541-9772563 TGGGCGCAGAGGTAGGGCCTGGG + Intergenic
926723914 2:15982881-15982903 AGGGAGCTGAGGAGGGGGCTTGG + Intergenic
927923252 2:26990276-26990298 GGGGCGCATAGGAGGGGGTGTGG - Intronic
928171866 2:29009518-29009540 AGGATGCAGAGGTGGGGGCGGGG + Intronic
928934768 2:36664047-36664069 AGGGAACAGAGGAGGGTCGGGGG - Intergenic
929452741 2:42047943-42047965 AGGGGGCGGGGGAGGGGGCGGGG + Intergenic
929883838 2:45861035-45861057 TGGGGGCAGAGGAAGGGCCTCGG + Intronic
930198268 2:48530075-48530097 AGGGCGGGGAGGGGCGGCCGCGG - Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
931443508 2:62307778-62307800 AGGGCACCAGGGAGGGGCCGAGG + Intergenic
932462030 2:71888621-71888643 AGGGCTGAGAGGAGTGGTCGTGG + Intergenic
932562870 2:72887982-72888004 AGGGCGCAGAGCAAGGGGCTCGG - Intronic
932606031 2:73166339-73166361 GGGGCGCAGGGGAGGAGCCAGGG - Intergenic
932692575 2:73925879-73925901 AGGGGGCTGGGGAGGGGCCGGGG - Intergenic
933926395 2:87094111-87094133 GGGGCGCAGGGGAGGAGCCAGGG + Intergenic
933955330 2:87357873-87357895 AGGGCCAAAAGGAGGGGCCAGGG - Intergenic
934239518 2:90254086-90254108 AGGGCCAAAAGGAGGGGCCAGGG - Intergenic
934273677 2:91562657-91562679 AGGGCCAAAAGGAGGGGCCAGGG + Intergenic
934461962 2:94217440-94217462 AGGGCCAAAAGGAGGGGCCAGGG - Intergenic
934640309 2:96023823-96023845 ACGGGGCAGAGGAGGAGCCTGGG + Intronic
934856573 2:97733599-97733621 AGCGGGCAGAGGTGGGGACGCGG + Intronic
934973945 2:98787179-98787201 AGGGCTCAGGGGTGGGGCTGGGG + Intergenic
935593530 2:104862559-104862581 TGGGCGCGGAGGTGGGGCGGTGG + Intergenic
936250696 2:110866253-110866275 AGGCAGGAGAGGAGGGGCAGAGG + Intronic
936566134 2:113584010-113584032 AGGGCGCAGCGGAGGGTGAGCGG + Intergenic
936962351 2:118088765-118088787 AGGGGGTATAGGAGGGGTCGAGG + Intronic
937072213 2:119073136-119073158 AGGGAGCAGAGGAGGGATGGAGG + Intergenic
937258101 2:120568890-120568912 GGGGCACAGAGAAGGGGCAGTGG - Intergenic
937777536 2:125797312-125797334 AGGGGGAAGAGGAGGGGGAGGGG + Intergenic
937907292 2:127058530-127058552 AGGGCTCAGAGGAGGGTGTGGGG - Intronic
937953745 2:127407998-127408020 AGGGGGAAGAGGAGGGGGCGGGG - Intergenic
937989191 2:127653046-127653068 ACGGTGCAGTGCAGGGGCCGAGG - Intronic
938263862 2:129912667-129912689 AGGGCACAGAGGAGGGGCTGAGG + Intergenic
938337328 2:130511427-130511449 TGTGCGCGGAGGAGGGGCCTTGG - Intergenic
938352510 2:130609308-130609330 TGTGCGCGGAGGAGGGGCCTTGG + Intergenic
939189594 2:138901371-138901393 AGGGAGGAGAGGAGGGGCCTGGG + Intergenic
941686966 2:168456825-168456847 CGGGCGCCGGGGAGGAGCCGCGG + Intronic
941808725 2:169734449-169734471 CGGGCGCGGGGGAGGGGGCGAGG + Intronic
944403930 2:199360909-199360931 AGGGTGCAGTGGAGGGGCAGGGG - Intronic
945404069 2:209423983-209424005 GGGGCGGGGAGGAGGGGCCGAGG + Intergenic
946154162 2:217796292-217796314 CGGGGGCACAGGAGGGGCAGAGG - Intergenic
946354962 2:219178638-219178660 CGGCCGCGGAGGAGGGGGCGGGG + Intronic
946368546 2:219266307-219266329 GGTGGGCAGAGGAGGGGCCAGGG - Intronic
946401599 2:219471456-219471478 AGGGCTTAGGGGAGGGGCCTTGG + Intronic
946902293 2:224384162-224384184 AAGGCCCAGTGGAGGGGCTGTGG - Intronic
947729015 2:232417996-232418018 AGGGGGCAGGGGAGGGGCCTGGG + Intergenic
947754384 2:232550954-232550976 AGGGCGAAGAGCTGGGCCCGGGG + Intronic
948282105 2:236754697-236754719 AGGCAGGAGAGGAGGGGCCTTGG + Intergenic
948363620 2:237439883-237439905 AAGGTGCTGAGGAGGGGCAGAGG - Intergenic
948612984 2:239181280-239181302 AGGGAGGAGAGGAGGGGCTGAGG + Intronic
948670727 2:239566946-239566968 AGGGAGCCGAGGAGAGGCCTGGG + Intergenic
948779489 2:240310146-240310168 AGGGGGGACAGGAGGGGCCCTGG - Intergenic
948851780 2:240711802-240711824 AGGGGACACAGGAGGGGCCCTGG + Intergenic
948918471 2:241050552-241050574 ACAGAGCAGGGGAGGGGCCGTGG - Intronic
949069874 2:242018056-242018078 GGGACGCAGGGGAGGGGCTGGGG + Intergenic
949069883 2:242018076-242018098 GGGACGCAGGGGAGGGGCTGGGG + Intergenic
949069892 2:242018096-242018118 GGGACGCAGGGGAGGGGCTGGGG + Intergenic
1168743354 20:213976-213998 AGGGTGCATAGGAGCGGCAGTGG - Intergenic
1169511160 20:6265695-6265717 AGGGCCCAGAGGGGTAGCCGGGG + Intergenic
1170756785 20:19212442-19212464 AGGGGGCAGAGGAGGAGGAGCGG - Intergenic
1170788895 20:19491637-19491659 TGGGAACAGAGGAGGGGCAGGGG - Intronic
1170890132 20:20369007-20369029 AGGGCCCGGTGGAGGCGCCGCGG + Exonic
1171419964 20:25011482-25011504 AGTCCTCAGAGGAGGGGCCCAGG + Intronic
1171482113 20:25461796-25461818 TGTGTGTAGAGGAGGGGCCGGGG - Intronic
1172106989 20:32522828-32522850 AGAGCTCAGTGGAGGGCCCGGGG + Intronic
1172320600 20:33993256-33993278 AGGGAGGGGAGGAGGGGCCCCGG - Intergenic
1172356081 20:34280972-34280994 AGGGAGGAGAGGTGGGGCCTGGG + Exonic
1172597056 20:36156723-36156745 AGGGCTGAGAGAAAGGGCCGTGG + Intronic
1172777900 20:37417826-37417848 AGGGAGAGGAGGAGGGGCCGAGG - Intergenic
1173799552 20:45886604-45886626 AGGGTGCTGTGGAGGGGGCGCGG - Exonic
1174375639 20:50124840-50124862 AGGTGGCTGAGGAGGGGCCGAGG + Exonic
1174380803 20:50154101-50154123 AGGGCGCCGGGCTGGGGCCGAGG + Intergenic
1174804657 20:53594387-53594409 TGGGCGCTGGGGCGGGGCCGGGG - Intronic
1174843218 20:53919209-53919231 AGGGCGAAGGGGAGGGGTCGCGG - Intergenic
1175140879 20:56859620-56859642 AGGGCCCAGAGAAGGGGCAAAGG - Intergenic
1175337410 20:58205495-58205517 CGGGCGCAGACGTGGGGACGTGG - Intergenic
1175337502 20:58205874-58205896 CGGGCGCAGACGTGGGGACGTGG - Intergenic
1175337511 20:58205913-58205935 CGGGCGCAGACGTGGGGACGTGG - Intergenic
1175561333 20:59933382-59933404 TGGGCGGAGGGGAGGCGCCGAGG - Intronic
1175582412 20:60110923-60110945 AGGGTGCTGAGGAGGGGTAGAGG + Intergenic
1175764528 20:61583242-61583264 AGGGCTCTGAGGAGGGACAGAGG + Intronic
1175812052 20:61863732-61863754 TAGGTGCAGAGGAGGAGCCGAGG + Intronic
1175859704 20:62143628-62143650 AGGGCGGAGCGGCGGCGCCGCGG + Intergenic
1175921929 20:62454247-62454269 TGGGCCCAGAGGATGGGCCCGGG + Intergenic
1175922202 20:62455543-62455565 AGGGTGCAGAGAAGGGGCCTGGG - Intergenic
1175975210 20:62707565-62707587 AGGGAGCAGGGGAGGGGGCGGGG + Intergenic
1175992536 20:62796814-62796836 AGGGCGCGTGGGAGGGGGCGGGG - Intronic
1176040185 20:63061038-63061060 AGGCACCAGAGGAGGGGCCAGGG - Intergenic
1176059774 20:63167523-63167545 TGGGGGCTGAGGAGGGGCTGAGG - Intergenic
1176125529 20:63472982-63473004 AGGGGGGAGAGGAGGGGGAGTGG + Intergenic
1176126020 20:63475137-63475159 TGGGCGCAGAGGAGGGGACAGGG - Intergenic
1176137613 20:63531028-63531050 CGGGCTCAGAGGAGGGGCCGGGG + Intronic
1176148046 20:63574144-63574166 AGGGCGGAGGGGCGGGGGCGCGG - Intronic
1176150525 20:63588611-63588633 ATGGCGCAGAGGTGGGGTCTGGG + Exonic
1176182310 20:63756155-63756177 AGGGGACAGAGGAAGGGCCAAGG - Intronic
1176202044 20:63865498-63865520 CGGGAGCTGAAGAGGGGCCGCGG - Intronic
1176241975 20:64079554-64079576 AGCCCGGTGAGGAGGGGCCGGGG - Intronic
1176593040 21:8660377-8660399 AGGGCCAAAAGGAGGGGCCAGGG - Intergenic
1176733496 21:10521927-10521949 GGCGCGGAGAGGAGGGGACGGGG - Intronic
1178680497 21:34669522-34669544 AGGGCGCAGAGGAGGCGCCGAGG + Exonic
1179658754 21:42861526-42861548 ATGGTGAAGGGGAGGGGCCGGGG + Intronic
1179882874 21:44300651-44300673 AGGGCCCCGAGGAGGAGGCGCGG - Intronic
1179884821 21:44309373-44309395 AGGGGTGAGAGGAGGGGGCGGGG + Intronic
1180058839 21:45374528-45374550 AGGAGGCAGGGGAGGGGCAGGGG - Intergenic
1180064364 21:45405231-45405253 ATGGCGCCGAGGTGAGGCCGGGG + Intronic
1180066836 21:45416532-45416554 AGGTCACAGAGGACGGACCGAGG - Intronic
1180066848 21:45416606-45416628 AGGTCACAGAGGACGGACCGCGG - Intronic
1180079504 21:45480329-45480351 TGGGGGCAGCAGAGGGGCCGTGG + Intronic
1180201975 21:46229496-46229518 GGGGCGGAGCGGAGGAGCCGAGG + Intergenic
1180275887 22:10637504-10637526 AGGGCCAAAAGGAGGGGCCAGGG - Intergenic
1180674937 22:17580713-17580735 AGGAGCCAGAGGACGGGCCGGGG + Intronic
1180711804 22:17844163-17844185 AGGAGGCAGAGAAGGGGCAGAGG + Intronic
1180760256 22:18196901-18196923 GGGGTGCAGAGGAGGGGCTGTGG + Intergenic
1180770568 22:18381199-18381221 GGGGTGCAGAGGAGGGGCTGTGG + Intergenic
1180808482 22:18738850-18738872 GGGGTGCAGAGGAGGGGCTGTGG - Intergenic
1180828511 22:18884157-18884179 GGGGTGCAGAGGAGGGGCTGTGG + Intergenic
1181071412 22:20343814-20343836 GGGGTGCAGAGGAGGGGCTGTGG - Intergenic
1181162094 22:20965256-20965278 GGGGCGAAGAGGCGGGGCGGCGG - Intronic
1181194484 22:21172764-21172786 GGGGTGCAGAGGAGGGGCTGTGG - Intergenic
1181214958 22:21320014-21320036 GGGGTGCAGAGGAGGGGCTGTGG + Intergenic
1181310786 22:21943707-21943729 AGGGCGCAGAGCAGGGTCCCAGG - Intronic
1181354288 22:22289329-22289351 AGGGCCAAAAGGAGGGGCCAGGG + Intergenic
1181637191 22:24179998-24180020 TGGGTGCAGGGGAGGGTCCGAGG - Intergenic
1182353456 22:29711448-29711470 ATGGCGAAGTGGAGGGGCTGGGG - Intergenic
1182423484 22:30259832-30259854 GGAGGGGAGAGGAGGGGCCGAGG + Intergenic
1182484291 22:30630092-30630114 AGGGCACATGGGAGGGGCTGTGG - Intergenic
1182586530 22:31346794-31346816 AGCGGGCAGGGGAGGGGCAGTGG - Intergenic
1182604081 22:31489853-31489875 GGGCCGAAGAGGAGGGGCGGAGG - Intronic
1183317214 22:37143277-37143299 AGGCTGCAGTGGAGGGGCTGGGG - Intronic
1183500283 22:38174779-38174801 GGTGCTGAGAGGAGGGGCCGTGG + Intronic
1183587650 22:38762396-38762418 AGGGAGCTGAGGAGGGGTGGGGG - Intronic
1183683685 22:39349922-39349944 CGCGCGCAGGGGAGGGGGCGGGG + Intronic
1183702222 22:39457257-39457279 CGGGCGCGGGGGAGGGACCGCGG - Intergenic
1183862294 22:40679007-40679029 AGGGCACAGGGAAGGGGCCGAGG + Exonic
1184111329 22:42397228-42397250 TGGGTGCAGCGTAGGGGCCGAGG - Intronic
1184129501 22:42509304-42509326 AGGCAGCAGGGGATGGGCCGGGG + Intergenic
1184190709 22:42892601-42892623 ACGTGGCAGAGGAGGGGCCTAGG - Intronic
1184240675 22:43209927-43209949 AGGGCAGAGAGGAGGGCCCTGGG - Intronic
1184345173 22:43908773-43908795 GGGGCCCAGAGAAGGGGCCGGGG + Intergenic
1184464458 22:44660640-44660662 AGGGCTCAGGGGTGAGGCCGAGG + Intergenic
1184521323 22:44995917-44995939 AGGGCACAGCGGAGGGGACGTGG + Intronic
1184557465 22:45240979-45241001 AGGGGACAGGGGCGGGGCCGGGG - Intergenic
1184640617 22:45868105-45868127 AGGCTTCAGAGGAGGGGCTGTGG - Intergenic
1184665071 22:45984066-45984088 AGGACGCAGAGGAGCAGCTGGGG - Intergenic
1184898119 22:47424192-47424214 AGTGCACAGAGGAGGGACAGAGG + Intergenic
1184915105 22:47563753-47563775 TGGGGGCTGAGGAGGGGCAGTGG + Intergenic
1185005909 22:48276947-48276969 AGGGGGCAGAGGAGGAGAGGAGG + Intergenic
1185070862 22:48654911-48654933 AGGGCTGGGAGGAGGGGCCGTGG + Intronic
1185315655 22:50178188-50178210 CGGGGGCAGGGGCGGGGCCGGGG - Exonic
1185320634 22:50198799-50198821 GGGGCTTATAGGAGGGGCCGAGG + Exonic
1185329477 22:50245743-50245765 AGGCCACAGAGGAAGGGCCTAGG + Exonic
1185402906 22:50627742-50627764 AGGGCCAGGAGGAGGGACCGCGG + Exonic
1203232403 22_KI270731v1_random:122371-122393 GGGGTGCAGAGGAGGGGCTGTGG + Intergenic
1203278605 22_KI270734v1_random:110146-110168 GGGGTGCAGAGGAGGGGCTGTGG + Intergenic
950101616 3:10360254-10360276 AGGGTGCAGGGGATGGGCCAAGG - Intronic
950105589 3:10386331-10386353 AGGGCACAAAGGAGGGTCTGGGG + Intronic
950183040 3:10928363-10928385 AGGGCGCAGAGGAGAGGGATGGG + Intronic
950487798 3:13283092-13283114 CGGGAGCCGAGGCGGGGCCGCGG - Intergenic
950568933 3:13788112-13788134 GGGGCGCAGGGGAGGAGCTGGGG - Intergenic
950612561 3:14135567-14135589 AGTGCGCAGAGCAGGGGATGGGG - Intronic
952884516 3:38004125-38004147 GGGGCTCAGAGGAGGGCCCAGGG + Intronic
953393076 3:42545212-42545234 AGGGATCAGAGCAAGGGCCGGGG - Intergenic
953561367 3:43995786-43995808 AGCGCGCAGGGGAGGGACGGCGG + Intergenic
953903533 3:46856976-46856998 AGGACTCAGGGGAGGGGCCCTGG + Intergenic
953909132 3:46883072-46883094 AGGGGGCGGGGGAGGGGTCGGGG - Intronic
954101003 3:48372581-48372603 AGGCCCCAGGGGAGAGGCCGGGG + Intronic
954194799 3:48990217-48990239 CGCGCCCAGGGGAGGGGCCGCGG - Exonic
954294396 3:49666108-49666130 AGGGAGAAGAGGAGGGTCCGAGG - Intronic
954301232 3:49701839-49701861 AGACCGCAGAGGAGCGGCTGCGG + Exonic
954370456 3:50167288-50167310 AGGGGTCAGTGGAGGTGCCGAGG + Intronic
954622884 3:52005799-52005821 CTGGCGCAGAGGAGGGGCCTGGG + Intergenic
955409997 3:58649212-58649234 AGGGCTCAGAGCAGGGGCCCTGG + Intronic
955421619 3:58743866-58743888 AGTGGGCAGAGGAGTGGCTGTGG - Intronic
955758251 3:62249298-62249320 AGGGCAGACAGGAGGGGCAGGGG + Intronic
956782594 3:72615917-72615939 CTGGCGCAAAGGAGAGGCCGTGG + Intergenic
957072902 3:75580026-75580048 AGGACGGAGAGGACGCGCCGCGG - Intergenic
960084475 3:113575905-113575927 AGGGCACATTGGAGGGGCAGGGG + Intronic
960221445 3:115114302-115114324 TGGGTGCAGAGGAGGGGTGGTGG + Intronic
960488142 3:118278236-118278258 AGGGGGGAGAAGAGGGGCCATGG + Intergenic
960995453 3:123337314-123337336 AGGGTGCAGAGCAGAGGCCAAGG - Intronic
961028903 3:123585088-123585110 AGGGGGCGGAGGAAGGGACGAGG + Exonic
961387316 3:126529957-126529979 AGGGCCCAGTGGAGGGACGGGGG + Intronic
961688221 3:128650334-128650356 CGGGGGCAGCGGAGGCGCCGGGG + Intronic
961818245 3:129562123-129562145 AGGGCACAGAGGAGGAGCTCTGG + Intronic
962816624 3:139006226-139006248 AGGGCGCAGGGAAGGCGCTGGGG + Exonic
963207625 3:142652567-142652589 AGGGCACAGAGTAGGAGGCGGGG + Intronic
965166274 3:165196772-165196794 TTGGCGCGGAGGAGGGGCCGGGG - Intronic
965404115 3:168249479-168249501 TGGGTGAAGAGGAGGGGTCGAGG + Intergenic
966772493 3:183516604-183516626 GGGAAGCAGAGGAGGGGCAGTGG - Intronic
966866574 3:184261623-184261645 AGGGGAAAGAGGCGGGGCCGGGG + Intronic
967055309 3:185825045-185825067 AGGGCGGGGAGGGGGGGCGGAGG - Exonic
967086007 3:186095928-186095950 AGTGCGCAGAGCAGGCGCTGTGG + Intronic
967795344 3:193593243-193593265 AGGGCACAGAGCCGCGGCCGAGG - Exonic
967904031 3:194486588-194486610 AGGCCGCGGAGGAGGCGGCGCGG - Intronic
968106803 3:196007108-196007130 GGGACGCAGGGGAGGGGCTGGGG - Intergenic
968135498 3:196216971-196216993 AGGTCGCAGAGCGGGGGCTGTGG + Intronic
968284244 3:197498939-197498961 AGGGCCGGGAGGAGGCGCCGGGG + Intergenic
968445819 4:651502-651524 AGGGCGCAGAGGGTGGGGCCGGG + Intronic
968498540 4:932363-932385 AGGCCGCGGCGGAGGGGACGGGG - Intronic
968514714 4:1011350-1011372 AGGGCGCGCGGGCGGGGCCGGGG + Intronic
968525697 4:1055561-1055583 AGGGCCCAGGGGAGGCGCCTGGG + Intergenic
968593288 4:1470383-1470405 AGGGGGCAGCTGAGCGGCCGTGG + Intergenic
968762874 4:2451407-2451429 AAGGCTCAGAGGAGGGGCCTGGG + Intronic
968794581 4:2694065-2694087 AGAGGGAAGAGCAGGGGCCGTGG + Intronic
968865542 4:3208982-3209004 AGAGTGCAGAGGAGGTGCCGTGG + Intronic
968920805 4:3521363-3521385 AAGGCCCAGAGGAGGCGCTGGGG - Intronic
969462494 4:7336169-7336191 AGGACGCAGGGCAGGGGCAGCGG - Intronic
969704378 4:8783994-8784016 TGGGGGCCCAGGAGGGGCCGGGG + Intergenic
970456391 4:16227183-16227205 GACGCGCAGGGGAGGGGCCGCGG + Intronic
972602108 4:40581945-40581967 TGGGTGCAGAGGAGGGGAAGCGG - Intronic
974875737 4:67701012-67701034 AGGGCGAAGGTGAGGGGTCGCGG - Intronic
976398470 4:84582791-84582813 AGCACGCAGAGGCGGGGGCGGGG + Intergenic
978384896 4:108168871-108168893 AGGGCGCGGAGGAGGGACCCGGG - Intronic
978530045 4:109703468-109703490 GGGCCGCCGAGGAAGGGCCGAGG - Exonic
982070779 4:151692655-151692677 AGGGGGCAGGAGAGGGGCAGAGG - Intronic
982087789 4:151853908-151853930 GGGGCCAAGGGGAGGGGCCGGGG + Intergenic
985562403 5:595722-595744 AGGGCACAGTGAAGGGGCCTTGG + Intergenic
985566395 5:620477-620499 AGGGCGCAGGGCTGGGGCCGTGG + Intronic
985652221 5:1112408-1112430 AGGGCGTGCAGGAGGGGCAGGGG - Intergenic
985658342 5:1143427-1143449 TGTGTGCAGAGGAGCGGCCGTGG - Intergenic
985685608 5:1280059-1280081 AGGGCCCGGAGGAGGGGCCACGG - Intronic
985765564 5:1777676-1777698 CGTGCGCAGAGGAGTGGCCGTGG + Intergenic
985988736 5:3538351-3538373 AAGGCCCATAGGAGGGGCTGAGG - Intergenic
986216023 5:5719963-5719985 CAGGCACAGAGGAGAGGCCGTGG - Intergenic
986242391 5:5972806-5972828 ATGGTGCAGAGGTGGGGCCAGGG - Intergenic
986741681 5:10710584-10710606 AGGGTGCAGAGGAAGGCACGAGG + Intronic
987119454 5:14753067-14753089 AGGACCCAGAGGAGTGGCCCTGG + Intronic
987258461 5:16180089-16180111 AGGGGGCAGGGGAGAGGCCGCGG + Intronic
988727250 5:33937640-33937662 GGGGACCAAAGGAGGGGCCGCGG + Exonic
988796443 5:34656785-34656807 GGGGCGCGGGGCAGGGGCCGCGG + Intronic
989229981 5:39074462-39074484 AGGGGGCGGGGGAGGTGCCGCGG - Intergenic
990951400 5:61302094-61302116 AGGGCACACAGAAGGGGCCCTGG - Intergenic
991475180 5:67011224-67011246 AGGCTGCAGGGGAGGGGCTGGGG - Intronic
991720623 5:69492394-69492416 GGGGCGCAGAGGAGAGGCGCGGG - Exonic
994090188 5:95803008-95803030 AGGGCTCAGGGGAGAGGCCTAGG + Intronic
994710394 5:103258701-103258723 AGGAGGCGGAGGAGGGGGCGGGG + Exonic
995571668 5:113488167-113488189 AGGGGGCAGAGCAGGGGTCAAGG + Intronic
995718787 5:115107419-115107441 GGGGCTCAGAGGAGAGGTCGAGG + Intergenic
997239098 5:132294131-132294153 CGGGCGCAAGGGAGGAGCCGAGG - Intronic
997349100 5:133217449-133217471 AAGGCACAGAGGAGGGTCAGGGG - Intronic
997368724 5:133342322-133342344 AGGTTGCAGAGAAGGGGCAGGGG + Intronic
997579701 5:135009549-135009571 ATGGCCAGGAGGAGGGGCCGTGG + Intronic
997649975 5:135509707-135509729 AGACATCAGAGGAGGGGCCGAGG - Intergenic
998370224 5:141656016-141656038 AGGGTGCAGAGGTGGGCCAGAGG + Intronic
999386180 5:151156007-151156029 AGTGTGCAGAGGAGGGGCCAGGG - Intronic
999480146 5:151940787-151940809 AGGGAGCAGTGCAGGGGCCATGG + Intergenic
1001279834 5:170378798-170378820 AGGGAGAAGAGGAGGGCCTGGGG + Exonic
1001648132 5:173297311-173297333 CGGGCCCTGAGGAGGGGCTGGGG - Intergenic
1002468361 5:179419751-179419773 AGGACGCAGAGCAGTGTCCGCGG + Intergenic
1002532841 5:179858935-179858957 AGTGCGCAGGGGCGGGGCCGCGG - Intronic
1002565646 5:180111688-180111710 AGGGCTCTGAGGAGGAGCAGGGG + Intronic
1002622018 5:180494626-180494648 AGGCGGCAGAGGAGCGGCGGCGG + Exonic
1003086373 6:3064287-3064309 AGGGCAGCGAGGAGGCGCCGGGG - Intronic
1003159548 6:3623607-3623629 GGGGCTGAGAGGAGGGGCAGTGG - Intergenic
1003324893 6:5084471-5084493 AGGGCGGAGAGGGGGCCCCGTGG - Intergenic
1003603717 6:7541660-7541682 AGGGCGCAGAGGAGCTGCGTCGG - Exonic
1003624414 6:7728364-7728386 AGGGTGCGGGGTAGGGGCCGGGG + Intronic
1004025260 6:11811929-11811951 TGGGGGCAGAAGAGGGGCCTTGG + Intergenic
1004561961 6:16760548-16760570 GGGGCGCAGAGGGGTGGCCTCGG - Intronic
1004713416 6:18193728-18193750 AAGGAGCAGAGGAGAGGCCTGGG + Intronic
1006056860 6:31391531-31391553 GGCGTGCAGGGGAGGGGCCGAGG - Intergenic
1006069568 6:31488432-31488454 GACGTGCAGAGGAGGGGCCGAGG - Intergenic
1006088993 6:31616687-31616709 AGGGGGAAGAGGAAGGGCAGGGG - Intronic
1006134737 6:31888587-31888609 TGGACGGAGAGGTGGGGCCGTGG - Exonic
1006193493 6:32223355-32223377 AGGGGTCAGAAGAGGGGCGGAGG + Intronic
1006386396 6:33733416-33733438 GGGGAGCAGAGGAGGGGATGAGG + Intronic
1006503431 6:34472857-34472879 GGGGCACAAAGGAGGGGCCGGGG + Intronic
1006749137 6:36365660-36365682 AGAGCAGAGAGGTGGGGCCGGGG + Intronic
1006981951 6:38154270-38154292 AGCAGGCAGAGGAGGGGGCGGGG - Exonic
1007365991 6:41393361-41393383 AGAGGGCAGAGCAGGGGCCATGG - Intergenic
1007431580 6:41780123-41780145 GGGGCGCGGAGGCGGGGCTGAGG + Intronic
1007788448 6:44295428-44295450 AGGATGCAGAGTAGGGGCCCAGG - Intronic
1009826685 6:68875201-68875223 AGGGGGAAGGAGAGGGGCCGGGG - Intronic
1012476699 6:99621515-99621537 AGGGGGCAGAGGTGGGGCTGGGG + Intergenic
1013117623 6:107114963-107114985 CGGGAGCAGGGGAGGGGACGCGG - Intronic
1013480527 6:110549351-110549373 TGGGGGCAGAGGAGGGCCCTTGG - Intergenic
1015988590 6:138911792-138911814 AGGGAGAGGAGGAGGGGACGAGG + Intronic
1016898308 6:149075567-149075589 AGGTGGCAGGGGAGGGGCAGTGG - Exonic
1017021401 6:150143069-150143091 GCGGCGCAGAGCAGGTGCCGGGG + Exonic
1017324659 6:153131263-153131285 AGGATGCAGAGGAGGGGGAGGGG + Intergenic
1017446316 6:154510204-154510226 CGGGCGCAGGGGAGCAGCCGCGG - Exonic
1017671933 6:156777594-156777616 GATGCGCACAGGAGGGGCCGCGG + Intergenic
1018452204 6:163919508-163919530 AGGGAGGGGAGGAGGGGCAGCGG + Intergenic
1018990688 6:168671437-168671459 AGGACGGAGAGGAGGGACCAGGG - Intronic
1018990707 6:168671490-168671512 AGGACGGAGAGGAGGGACCAGGG - Intronic
1019121837 6:169810431-169810453 AGGGCTCAGGGGAGTGGCCTCGG + Intergenic
1019121854 6:169810488-169810510 AGGGCTCAGGGGAGTGGCCTCGG + Intergenic
1019198455 6:170295974-170295996 GCGGCGCAGAGGAGGGGGCGGGG - Intronic
1019312941 7:371620-371642 AGGATGCAGAGGTGGGGCCGTGG + Intergenic
1019379629 7:714067-714089 AGGAGGGAGTGGAGGGGCCGCGG - Intronic
1019386305 7:758058-758080 AGGGAGCGGGGGAGGGGCCCGGG + Intronic
1019472839 7:1230273-1230295 AGGGCGCGGGGGAGGGGGAGGGG + Intergenic
1020096741 7:5373848-5373870 CTGCCGCTGAGGAGGGGCCGGGG + Intronic
1020117960 7:5487011-5487033 AGGGCGCAAAGCAGGGGGCGGGG + Intronic
1020118706 7:5491055-5491077 AAGGAGCAGAGGCTGGGCCGTGG + Intronic
1020272590 7:6606282-6606304 AGGGCCCCCAGGAGGGGCTGAGG - Intronic
1021820386 7:24492296-24492318 AGGGGGCACAGGATGGGCCCAGG + Intergenic
1022096020 7:27142329-27142351 AGGGGGCAGGAGAGGGGCCAGGG - Intronic
1022489724 7:30807361-30807383 AGGGAGCTGAGCAGGGGCAGAGG - Intronic
1022505608 7:30907281-30907303 GGGGAGCAGAGGAAGGGCCCAGG - Intergenic
1023849510 7:44142210-44142232 AGGGCACAGCAGAGGGGCTGGGG + Intergenic
1023863261 7:44227550-44227572 AGGGGACAGAGGAGGGTCTGGGG + Intronic
1024520372 7:50300576-50300598 AGGATGCAGAGGAGAGGCAGGGG - Intergenic
1025777107 7:64569453-64569475 AGGGCGGAGAGGAGGGCCAGGGG + Intergenic
1026077547 7:67186268-67186290 AGGGGGGAGAGGTGGGGCGGGGG - Intronic
1026128872 7:67604124-67604146 ATGGGGCAGAGGAGGGGAAGAGG + Intergenic
1026134382 7:67646609-67646631 AGTCTGCAGAGGAGGGGCCCTGG + Intergenic
1026699318 7:72625879-72625901 AGGGGGGAGAGGTGGGGCGGGGG + Intronic
1026969594 7:74459898-74459920 AGGGCTCAGTGGAGGCCCCGGGG + Intronic
1027211173 7:76150155-76150177 GGCGCGCAGGGGAGGGTCCGCGG - Intergenic
1027397137 7:77767761-77767783 AGGGGGGAGAGGAGGGGAAGGGG - Intronic
1027397156 7:77767798-77767820 AGGGGGCAGAGGAAGGGAAGGGG - Intronic
1029537535 7:101165090-101165112 ATGGCTCAGGGAAGGGGCCGAGG - Intronic
1031595061 7:123640637-123640659 AGGGGGGAGAGGAGGGGGAGGGG + Intergenic
1031595071 7:123640655-123640677 AGGGGGGAGAGGAGGGGGAGGGG + Intergenic
1031604076 7:123748465-123748487 AGGGCGCCGACGAGGGGCCGGGG + Intronic
1032086111 7:128884751-128884773 AGGGCACAGTGGTGGGGCTGGGG - Intronic
1032188851 7:129751080-129751102 AGGGAGCAGAGGAGGAGCATCGG + Intronic
1032279934 7:130492104-130492126 CTGCCGCAGAGGAGGTGCCGGGG - Exonic
1032578440 7:133081247-133081269 AGGTCACAGAGGAGGCGCCTGGG + Intronic
1034443845 7:151101718-151101740 CTGCCGCAGAGGAGGGGCCCAGG + Intronic
1034562505 7:151890305-151890327 AAGGAGCAGAGGAAGGGCCAGGG - Intergenic
1034911546 7:155002602-155002624 AGGGCGCGCACTAGGGGCCGAGG + Intronic
1034971979 7:155424853-155424875 AGGCTGCAGATGAGGGGCCACGG + Intergenic
1035004302 7:155644083-155644105 CGGGCGCGGAGAAGGGGACGGGG + Intronic
1035025500 7:155822349-155822371 AAGGCACAGAGGAGGGGGAGAGG - Intergenic
1035249613 7:157588383-157588405 GGGAGGCAGGGGAGGGGCCGCGG - Intronic
1035350496 7:158242194-158242216 AAGGTGCAGAGGACGGGGCGGGG - Intronic
1035389847 7:158496989-158497011 AGGGCGCAGGGAAGGGGGAGGGG - Intronic
1035389857 7:158497009-158497031 AGGGCGCAGGGAAGGGGGAGAGG - Intronic
1036605455 8:10301772-10301794 ACGGAGGAGAGGAGGGGCTGGGG + Intronic
1036768663 8:11564449-11564471 AGGGCGCAGAGGCGGGGACGCGG - Exonic
1037753233 8:21696088-21696110 AGGGGACAGAGGAGGGGGAGGGG - Intronic
1037817242 8:22118747-22118769 GGGGCTCAGAGAAGGGGCAGGGG - Intronic
1038348501 8:26754828-26754850 ATGGAGCAGAGGTGGGGCAGGGG - Intronic
1038412098 8:27366849-27366871 AGGGTGCAGAGGAGAGGGTGTGG + Intronic
1038425411 8:27461244-27461266 AGACCTCAAAGGAGGGGCCGTGG - Exonic
1038928880 8:32171080-32171102 AGGGAGGAGAGGAGAGGCTGAGG + Intronic
1038963724 8:32548921-32548943 AGGGCGAAGAGGACGGGCGAGGG - Intronic
1039921285 8:41896190-41896212 TGGGCGTAGAGGAGGGACGGAGG - Intronic
1039922831 8:41905308-41905330 AGGGCCCGGGGGAGGGGCAGTGG - Intergenic
1040466207 8:47697642-47697664 AGTGCGCAGAGGAGGCTCCCAGG + Intronic
1041026401 8:53691066-53691088 GGCATGCAGAGGAGGGGCCGTGG + Intergenic
1041280933 8:56211016-56211038 AGGGGGCAGAGGAGCAGCGGCGG - Intronic
1041910750 8:63086087-63086109 CGGCCGCAGAGGCGGGGCCGAGG - Intergenic
1043472788 8:80578609-80578631 GGGGCGCAGGGGAGGAGCTGGGG - Intergenic
1043818209 8:84829562-84829584 AAGGCACTGAGGAGGGGCTGGGG - Intronic
1044656473 8:94553647-94553669 AGAACGCAGAGGGGGGGCAGAGG + Intergenic
1045305506 8:100952999-100953021 TGGGCGCCGAGGTGGGGGCGAGG + Intronic
1046357031 8:113100901-113100923 ATGGAGCAGAGGTGGGGCAGAGG + Intronic
1046647366 8:116800875-116800897 AGGGTTCAGAGGTGGGGCCAGGG + Intronic
1049042475 8:140123189-140123211 AGGGCTCTGAAGAGGGGTCGGGG - Intronic
1049165127 8:141120953-141120975 AGGGCTCAGGGAAGGGGCCCAGG + Intronic
1049208243 8:141373281-141373303 AGGCCTCAGAGGAGCGGCCCCGG + Intergenic
1049273128 8:141706646-141706668 AGGACACGGAGGAGGGGCAGGGG + Intergenic
1049361977 8:142216214-142216236 AGCCCTCAGAGGAGGGGCGGGGG - Intronic
1049366339 8:142238664-142238686 AGTGTGCAGGGGAGGGGCTGGGG - Intronic
1049405003 8:142448466-142448488 TGGAAGCAGAAGAGGGGCCGTGG + Intergenic
1049443384 8:142619227-142619249 GAGGGGCAGAGGAGAGGCCGGGG + Intergenic
1049603450 8:143518599-143518621 AGGCCGCAGAGGGGAGGTCGTGG + Intronic
1049774062 8:144396655-144396677 GCGGCGCAGAGGAGGGGGCTGGG - Exonic
1050365261 9:4868095-4868117 TGGGCCAAGAGGAGGGGCCGGGG + Intronic
1051659117 9:19409323-19409345 AGCGCGCCGAGGAGGGGGTGTGG - Intronic
1053105330 9:35403654-35403676 TGGGGGGAGAGGAGGGCCCGGGG + Intronic
1053293840 9:36899474-36899496 TGGGCTCAGAGGAGTGGCCTGGG - Intronic
1053346521 9:37382535-37382557 AGGACACAGAGGAGGAGACGTGG + Intergenic
1053692441 9:40593118-40593140 AGGGCCAAAAGGAGGGGCCAGGG - Intergenic
1054272375 9:63044415-63044437 AGGGCCAAAAGGAGGGGCCAGGG + Intergenic
1054303683 9:63394036-63394058 AGGGCCAAAAGGAGGGGCCAGGG - Intergenic
1054402461 9:64720546-64720568 AGGGCCAAAAGGAGGGGCCAGGG - Intergenic
1054436071 9:65204877-65204899 AGGGCCAAAAGGAGGGGCCAGGG - Intergenic
1054494321 9:65816810-65816832 AGGGCCAAAAGGAGGGGCCAGGG + Intergenic
1055513397 9:77016156-77016178 GGGGTGCAGAGCTGGGGCCGCGG - Intergenic
1056522269 9:87412064-87412086 GGGGCGCAGAGAAGAGGTCGGGG - Intergenic
1056708735 9:88972985-88973007 AGGGGGCTGAGGAGGGGCTGCGG - Intergenic
1056807602 9:89740982-89741004 AGGGGGCAGGGGTGGGGACGGGG - Intergenic
1057447983 9:95132075-95132097 AAGGAGCAGAGGAGGCGCCCAGG - Intronic
1057613488 9:96567367-96567389 AGGGCGCACTGCAGGGGCCCGGG - Intronic
1058764290 9:108166259-108166281 AAGGCGCAGAGGCAGGGCTGTGG - Intergenic
1059305348 9:113349590-113349612 AGGGCGCGGAGCCGGGGCCGGGG + Exonic
1059440336 9:114303044-114303066 AGGCTGCAGAGGAGAGGCCAGGG - Intronic
1060213346 9:121723770-121723792 AGGGCGGAGAGGAGGGTGCATGG + Intronic
1060225613 9:121788597-121788619 GGGGGGCAGAGGAGGAGTCGGGG + Intergenic
1060540095 9:124423572-124423594 AGGACGCAGAAGAGGAGCAGGGG + Intergenic
1060552697 9:124492997-124493019 GGGGCCCAGGGGCGGGGCCGAGG + Intronic
1060665137 9:125428241-125428263 AGTGCTCAGAGGTGGGGCCGCGG + Intergenic
1060801370 9:126547774-126547796 TGAGGGCAGAGGAGGGGCCAAGG - Intergenic
1060926468 9:127458920-127458942 AGAGCGCTGAGGAGGGGCTGGGG - Intronic
1060965528 9:127710494-127710516 AGGGCGCACAGGAAGGGACAGGG + Intronic
1061194866 9:129102228-129102250 AGGGAGGCCAGGAGGGGCCGTGG - Intronic
1061200653 9:129136656-129136678 AGGGAGCGCAGGAGGGGCAGGGG - Intronic
1061308308 9:129745560-129745582 AGGTGGCAGAGGAGGGGCCCAGG + Intronic
1061318019 9:129809437-129809459 AGGGCCGAGATGAGGGCCCGTGG + Exonic
1061368705 9:130186053-130186075 AGGGAGCAGAGGGGAGGCCCTGG + Intronic
1061802293 9:133119304-133119326 AGGGCCCAAGGGAGGGGGCGGGG - Intronic
1061804036 9:133128307-133128329 AGGGCGCAGAGGGGCTGCGGGGG + Intronic
1061868112 9:133505887-133505909 AGGTAGGAGAGGAGGGGCAGAGG - Intergenic
1062179989 9:135186185-135186207 AGGGCACAGGGGAGGAGCCCAGG - Intergenic
1062283021 9:135760296-135760318 ACTGAGCAGAGGAGGGGACGGGG + Intronic
1062363281 9:136197509-136197531 AGGCTGGAGAGGAGGGGCTGGGG + Exonic
1062481466 9:136754432-136754454 AGGGTGCCCAGGAGGGGCAGGGG + Exonic
1062566877 9:137167534-137167556 AGGGGGCAGAGGAGGGCGGGCGG - Intronic
1203623084 Un_KI270749v1:139184-139206 AGGGCCAAAAGGAGGGGCCAGGG - Intergenic
1186459930 X:9739953-9739975 AGTGGGGAGAGGAGGGGACGGGG + Intronic
1186669925 X:11758108-11758130 GGCGGGCGGAGGAGGGGCCGAGG + Intergenic
1187055419 X:15737985-15738007 AGGGCTCAGAGGCGTGGCCCAGG + Intronic
1187825578 X:23332210-23332232 AGGGCGGGGAGGAGGGGTGGCGG - Intergenic
1189116805 X:38351368-38351390 AGGAAGGAGAGGAGGGGCAGGGG - Intronic
1189198170 X:39168964-39168986 AGGGCTCAGGAGAGGGGCAGGGG + Intergenic
1189726075 X:43969364-43969386 AGGGGGCAGGGAAGGGGCCAAGG + Intronic
1189778301 X:44489883-44489905 AGTGCGCAGGGGTGGGGACGTGG - Intergenic
1190062727 X:47221582-47221604 AGGGAGTAGGGGAGGGGCTGGGG - Intronic
1190176915 X:48158029-48158051 AGGGGGCAGAGCAGTGGCCCAGG + Intergenic
1190203614 X:48384137-48384159 AGGGGGCAGAGTAGTGGCCCAGG + Intronic
1190206922 X:48411267-48411289 AGGGGGCAGAGTAGTGGCCCAGG - Intronic
1190660886 X:52653367-52653389 AGGGAGCAGAGTAGTGGCCCAGG - Intronic
1190667071 X:52705644-52705666 AGGGAGCAGAGTAGTGGCCCAGG - Intronic
1190672347 X:52752764-52752786 AGGGAGCAGAGTAGTGGCCCAGG + Intronic
1191184190 X:57592404-57592426 AGGAGGCCGAGGAGGGCCCGGGG + Exonic
1192148492 X:68697561-68697583 CAGGCGCAGGGGAGGGGCCTAGG - Intronic
1196098482 X:111824563-111824585 TGGGCCTAGAGGAGGGGCCTGGG + Intronic
1198099845 X:133414510-133414532 AGGGGGGAGAGGAGGAGCGGAGG + Intronic
1198307772 X:135399934-135399956 AGGGGACACAGGAGGGGCCTTGG - Intergenic
1198321477 X:135521829-135521851 AGGGGCCAGAGGAGGAGCCCAGG - Intronic
1199832938 X:151562802-151562824 AGGGGGCAGCGGGGGGGGCGGGG + Intergenic
1200093684 X:153647516-153647538 GGGGAACAGAGGAGGCGCCGAGG - Intronic
1200164772 X:154028559-154028581 GGGGAGCAGAGGAAGGGCTGGGG + Intronic
1200215949 X:154368359-154368381 TGGGCCCAGAGGAAGGGCAGAGG + Intronic
1201759000 Y:17518143-17518165 AGGGAGCTGAGCTGGGGCCGTGG - Intergenic
1201842555 Y:18387847-18387869 AGGGAGCTGAGCTGGGGCCGTGG + Intergenic