ID: 902415202

View in Genome Browser
Species Human (GRCh38)
Location 1:16234490-16234512
Sequence TGTCCAGCCCAGGATCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902415202_902415205 29 Left 902415202 1:16234490-16234512 CCCATCAGATCCTGGGCTGGACA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 902415205 1:16234542-16234564 TTTACCTTCTATTTTTAATACGG 0: 2
1: 0
2: 3
3: 73
4: 898

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902415202 Original CRISPR TGTCCAGCCCAGGATCTGAT GGG (reversed) Intronic
902187572 1:14736724-14736746 TGTTCAGCCCAGGATGTGCAAGG + Intronic
902188710 1:14745119-14745141 TGTCCAGATCAGGATCTGTCTGG - Intronic
902415202 1:16234490-16234512 TGTCCAGCCCAGGATCTGATGGG - Intronic
902685421 1:18073714-18073736 TTTCCAGCCCAGGTTCAGACTGG - Intergenic
903036031 1:20493124-20493146 TGTCCAGCCCAGGACCTGGCAGG - Intergenic
903469738 1:23577842-23577864 TGACCAGCCCAGGATCCAGTAGG - Intergenic
904909559 1:33923783-33923805 TGTGCAGCCCAGGTTCTAACAGG - Intronic
905027072 1:34858020-34858042 TGTGCAGCCCAGTTTCTAATGGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906213477 1:44025254-44025276 AGGCCAGCCCAGGATCTTGTGGG + Intronic
907342631 1:53747833-53747855 CCTCCAAACCAGGATCTGATGGG + Intergenic
910451331 1:87349036-87349058 TGTCCTGCCCTGGTTCTGAGGGG - Intergenic
911128145 1:94360759-94360781 TGTCGAGGCCAGGAGGTGATTGG - Intergenic
912948381 1:114103776-114103798 TGTCCAGTGCAGTATCTGCTGGG + Intronic
917897292 1:179504325-179504347 TGTCCACCCCAGGATGTGGTGGG + Intronic
917967669 1:180188614-180188636 TGTCCAGCCCAACGTTTGATAGG + Intronic
918825353 1:189316709-189316731 TGTCCATCCAGGGATCTGCTGGG + Intergenic
920376318 1:205510292-205510314 TGACCAGCCCAGGAGGTGACAGG + Intronic
922361911 1:224830396-224830418 TCTCCAGTCCATGCTCTGATAGG - Intergenic
1064165434 10:12981477-12981499 TGCCCAGCCCAGGATCCTTTTGG + Intronic
1069954341 10:72040575-72040597 TGTCCAGCCTTGGGTCAGATAGG - Intergenic
1071388410 10:85145111-85145133 TGTCCAGGCCAGGATGTTACTGG + Intergenic
1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG + Intronic
1075960713 10:126565846-126565868 TGTGCAGCACAGCATCTGAGAGG - Intronic
1076065191 10:127442908-127442930 TGTCCAGCCCAGGCTGTGTGAGG + Intronic
1077064655 11:635722-635744 AGTCCAGCCCAGCCTCTGGTCGG - Intergenic
1077155479 11:1089124-1089146 GGTCCAGCCCAGGGTCTCAGAGG - Intergenic
1078455541 11:11471831-11471853 TGCCCTGCCCAGGACCTGACTGG + Intronic
1079737080 11:24010659-24010681 TCTCCATCTCAGGATCTTATGGG + Intergenic
1084164828 11:67370729-67370751 TGTCCAGGCCAGGGACTGAGGGG - Intronic
1089163213 11:116455435-116455457 TCTGCAGCCCAGGAGCTGCTGGG + Intergenic
1090837242 11:130462425-130462447 TGGCTAGCCCAGAATCTGAATGG - Intronic
1090901723 11:131037999-131038021 TGTGTAGCCCAGGAACTGAAGGG - Intergenic
1092446205 12:8559759-8559781 TGTCCAGAGCAGGATTTGCTCGG + Intergenic
1095608481 12:44098956-44098978 GGGCCAGCCCATGATCTTATGGG + Intronic
1096783287 12:54003137-54003159 TTCCCAGCCCAGGAGCTGAGGGG + Exonic
1097748298 12:63324127-63324149 TGTGCAGCCCAGTTTCTAATAGG - Intergenic
1100793982 12:98160485-98160507 TGTTAAGCCCAGAAACTGATGGG + Intergenic
1102223554 12:111211482-111211504 CATCCAGCCCAGGTTCTGAAAGG - Intronic
1103535154 12:121628912-121628934 TGTCCAGCCAGGGATGTGTTAGG + Intronic
1104383618 12:128329521-128329543 TTCCCAGCCCAGGATCTACTGGG + Intronic
1108018169 13:46097533-46097555 AGTGGAGCCCATGATCTGATAGG - Intronic
1111265560 13:85807839-85807861 TGTGCAGCCCAGTTTCTAATAGG - Intergenic
1114297795 14:21345696-21345718 TGTCCAGCCCATAGTCTTATAGG + Intronic
1114634948 14:24182149-24182171 TGTGCAGCCCTGTTTCTGATGGG + Exonic
1120216369 14:81684612-81684634 AGTCTAGTACAGGATCTGATGGG + Intergenic
1120881823 14:89419605-89419627 TCTCCAGCCCATGCTCAGATGGG - Intronic
1122107150 14:99466828-99466850 TGTCCAGCCAAGAAGCTGGTAGG + Intronic
1123161032 14:106277987-106278009 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123165999 14:106325213-106325235 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1123208738 14:106738539-106738561 TGGCGAGTCCAGGAACTGATGGG + Intergenic
1202898778 14_GL000194v1_random:24221-24243 GGCCCAGCACAGGGTCTGATGGG + Intergenic
1128809585 15:70561172-70561194 AATCCAGCCCATGCTCTGATTGG + Intergenic
1129974650 15:79812115-79812137 TGCCCTGGCCAGGATCTGGTGGG + Intergenic
1138378551 16:56584074-56584096 GGTCCGGGCCAGGATCTGCTTGG + Intergenic
1142624895 17:1185754-1185776 AGGCCACCCCAGGATCTGACAGG - Intronic
1144101715 17:11947738-11947760 TGGCCAGCCCAGAATCTGGGAGG + Intronic
1144622016 17:16823880-16823902 TGTGGAGCCCAGGGGCTGATGGG - Intergenic
1151164638 17:72193182-72193204 TCTCCAGCCAGGGATATGATGGG + Intergenic
1152592813 17:81222230-81222252 TGTCCCTCCCAGGACCTGAAGGG + Intronic
1152667483 17:81579690-81579712 TGTCCAGCAAAGGAGCTAATTGG - Intronic
1203162389 17_GL000205v2_random:63654-63676 GGTCCAGCACAGGGGCTGATGGG + Intergenic
1153101844 18:1480539-1480561 TGTCAAGGCCAGGACCTGGTGGG - Intergenic
1154344057 18:13527834-13527856 TCTCCAGCCCCAGACCTGATGGG - Intronic
1154472496 18:14718510-14718532 TATCCAGCACAGCATTTGATAGG + Intergenic
1154951635 18:21216025-21216047 TGTCCTGCCCAAAATCTGTTTGG - Intergenic
1157339466 18:46766502-46766524 TGGTCAACCAAGGATCTGATAGG - Intergenic
1157859561 18:51128634-51128656 AGTCCAGGGGAGGATCTGATTGG + Intergenic
1158768517 18:60485787-60485809 TGTGAAGGCCAGGACCTGATAGG + Intergenic
1161377751 19:3948915-3948937 TGCCCAGCCCAGGGTAGGATTGG - Intergenic
1161973843 19:7598049-7598071 CGCCCAGCCCAGCACCTGATAGG - Intronic
1162182888 19:8882790-8882812 TGTCCAGCCCAGGGCCTGTGGGG + Exonic
1163502260 19:17683336-17683358 TGCCCAGCCCAGCATTTCATAGG - Intronic
1168655112 19:58121836-58121858 AGTCCATCCCAGAATCTGAAAGG + Intergenic
931668561 2:64627094-64627116 AGTCCAGCCCATGCTCTGAGTGG - Intergenic
932148746 2:69348675-69348697 AGTCCACCCGAGGAGCTGATGGG - Intronic
933359062 2:81254301-81254323 AGACAAGCCCAGGACCTGATGGG - Intergenic
934512235 2:94954593-94954615 TGTCGAGTCCAGGAACTGATGGG + Intergenic
935745826 2:106189538-106189560 TGGCCTGCCCAGGAGCTGAGCGG - Intronic
938291427 2:130152797-130152819 TGGCCAGCCCAGGTTCTGTGAGG + Exonic
938465117 2:131520162-131520184 TGGCCAGCCCAGGTTCTGTGAGG - Intergenic
947379169 2:229528483-229528505 TATCATCCCCAGGATCTGATAGG + Intronic
947587587 2:231366102-231366124 TGGCAAGCGCAGAATCTGATGGG + Intronic
947904376 2:233749674-233749696 TGTCAAGGACAGGATCTGGTGGG + Intronic
948970328 2:241420783-241420805 TGTGGAGCCCAGGGTCTGCTGGG - Intronic
1170798975 20:19574833-19574855 TGTCAAGTCTAGGACCTGATGGG + Intronic
1171060257 20:21949705-21949727 TGACCAGCCCAGCCTCTGTTGGG - Intergenic
1171208513 20:23299491-23299513 TGTGCAGCCCAGGAGCTGGCTGG + Intergenic
1172107295 20:32524404-32524426 TGTCCACCCGTGGATCAGATAGG - Intronic
1172855260 20:37996832-37996854 GGTCCAGCCCTGGCACTGATGGG + Exonic
1173164737 20:40679410-40679432 TGCACAGCCCTGGATCTGACAGG + Intergenic
1176241102 20:64076372-64076394 TGTCCTGTCCAGGGTCTGTTGGG - Intronic
1176717828 21:10368369-10368391 TCAACAGCCCAGGATCTGCTCGG + Intergenic
1176801994 21:13439383-13439405 TATCCAGCACAGCATTTGATAGG - Intergenic
1180299055 22:11021275-11021297 TCAACAGCCCAGGATCTGCTCGG + Intergenic
1182490034 22:30665485-30665507 GGACCAGATCAGGATCTGATGGG - Intronic
1183376762 22:37469816-37469838 TGGCAAGCCCAGGATCTGAGTGG - Exonic
950826643 3:15830350-15830372 TATCCAGCCCAGTTTCTGACAGG - Intronic
955009555 3:55000842-55000864 TCCCCAGCCCAGGGTCTTATTGG - Intronic
955094899 3:55787502-55787524 TGTCTAGCCCTGTATCTGAATGG - Intronic
961194961 3:124993806-124993828 TGTCCTGCCCGCGAGCTGATGGG + Intronic
961302066 3:125928493-125928515 AGGCCAGGCCAGGATCAGATGGG + Intergenic
962981385 3:140493598-140493620 TGTCCAGCCCCTGACATGATAGG - Intronic
968271568 3:197407318-197407340 TCTCCAACCCAGGATGTGTTTGG + Intergenic
968995577 4:3943352-3943374 AGGCCAGGCCAGGATCAGATGGG - Intergenic
969509829 4:7611460-7611482 TGCCCAGCCCAGGAGCTGTTGGG + Intronic
982289539 4:153765983-153766005 AGTCCATGCCAGCATCTGATTGG + Intergenic
984919212 4:184749220-184749242 TTTGCAGCCCAGAATCTGACTGG - Intergenic
985405008 4:189629129-189629151 TGTCCAGCCCCGAATTTCATCGG + Intergenic
985958506 5:3282196-3282218 TGGCCAGCCAAGGATGTGAGGGG + Intergenic
988429270 5:31100554-31100576 TGTCCAGCCCAGTACATGGTAGG + Intergenic
990149612 5:52801014-52801036 TGGCCAGCCCAGGATTTGTGAGG + Exonic
993701256 5:91121497-91121519 TGTCAACCCCCGGAGCTGATGGG + Intronic
995422200 5:111980238-111980260 TGTCCATCCCAGTATTTGTTAGG - Intronic
998191938 5:140032816-140032838 TGGCCAGCCAAGGACCTGAGGGG + Intronic
998856130 5:146396837-146396859 TATGAAGCCCCGGATCTGATTGG - Intergenic
999152209 5:149433807-149433829 TGTGCATCCCAGGAGCTGAGAGG + Intergenic
999276592 5:150335017-150335039 TTTCCAGCCCCAGCTCTGATAGG + Intronic
1002440230 5:179260535-179260557 TTGCCAGCCCAGGCTCTGAGCGG + Intronic
1003224171 6:4189726-4189748 CCTCCAGCTCAGGATCTTATAGG - Intergenic
1003342701 6:5237156-5237178 TGTGCAGCCCAGTTCCTGATAGG - Intronic
1006392067 6:33764351-33764373 TTTGAAGCCCAGGATCTGTTGGG - Intergenic
1009730197 6:67592624-67592646 TGTCCAGCTCTGGAGCTGATGGG + Intergenic
1026858688 7:73770793-73770815 TGTCCAGCCCAGGAATTGCTGGG + Intergenic
1028957264 7:96707951-96707973 TGTCCAAGCCAGGATCTGAAAGG - Intronic
1029380533 7:100211504-100211526 TGCCCAGGCCAGGACCTGAAGGG - Exonic
1029948039 7:104554387-104554409 TTTCCAGCCAACAATCTGATTGG + Intronic
1032710063 7:134453360-134453382 AGTCCAGCCCCGGTTCTGCTGGG + Intronic
1037608247 8:20455431-20455453 CTTCCAGCCCAGAATTTGATGGG - Intergenic
1037751004 8:21682445-21682467 TGTCCAGGCCAGGCTCTTACAGG - Intergenic
1037832984 8:22199907-22199929 TCTCCAACCCAGGATCAGGTAGG - Intronic
1037908566 8:22729670-22729692 AGTCAAGCACAGGATCTGCTGGG - Intronic
1038200077 8:25403703-25403725 CTTCCAGACCGGGATCTGATGGG + Exonic
1039329283 8:36519253-36519275 CCACCAGCCCAGGATGTGATTGG + Intergenic
1040107019 8:43547023-43547045 GGTCCAGCGCAGAATCTGATGGG + Intergenic
1043727636 8:83630198-83630220 TGTGCAGCCCAGTTTCTAATAGG - Intergenic
1048304246 8:133272568-133272590 TGTCCAGGCCAGGCTCTGCCAGG - Intronic
1048743470 8:137587786-137587808 TGACCAGACCAGGATCAGCTGGG - Intergenic
1048782603 8:138018027-138018049 TGTCCAGCAAGGGATCTGGTAGG + Intergenic
1049032496 8:140048033-140048055 TGGCCAGCCCAGCTTCTGCTGGG - Intronic
1054350676 9:64015367-64015389 GGCCCAGCGCAGGGTCTGATGGG + Intergenic
1057242018 9:93419762-93419784 TGTCCACCTGAGGGTCTGATAGG - Intergenic
1057243177 9:93430793-93430815 TGCCCAGCCAAGGATCTGTTAGG - Intergenic
1059920854 9:119158295-119158317 TCTCCAGCACAGGAACTGAGTGG - Intronic
1060175478 9:121494430-121494452 TCTCCAGCCAAAGAGCTGATTGG - Intergenic
1062398520 9:136362427-136362449 TCTGCAGCCCCGGGTCTGATGGG + Intronic
1187622946 X:21078888-21078910 TCTCCAGCCCAGCAGCTGCTTGG - Intergenic
1188065586 X:25655761-25655783 TGGCCAGCCCAGATTCTGAGGGG + Intergenic
1190260859 X:48795985-48796007 TGTCCAGCACAGGTTCTGAAGGG - Intergenic
1195683505 X:107565807-107565829 TGTCCACCCCAGGTTCTGCCTGG + Intronic
1198078865 X:133219773-133219795 TGTCCAGCTCTGGTTCTGTTAGG - Intergenic
1201151848 Y:11099048-11099070 GGCCCAGCACAGCATCTGATGGG + Intergenic
1201152609 Y:11102193-11102215 TGCCCAGCGCAGGGGCTGATGGG + Intergenic
1201889266 Y:18923746-18923768 TGAACAGCCAAGGATCTGAAAGG + Intergenic