ID: 902435439

View in Genome Browser
Species Human (GRCh38)
Location 1:16395471-16395493
Sequence TAAACTGTTATTGCTGGCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 2, 2: 0, 3: 8, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902435439_902435442 -4 Left 902435439 1:16395471-16395493 CCAGTGCCAGCAATAACAGTTTA 0: 1
1: 2
2: 0
3: 8
4: 98
Right 902435442 1:16395490-16395512 TTTATCATGCTCATTAATTTGGG 0: 4
1: 0
2: 4
3: 41
4: 359
902435439_902435441 -5 Left 902435439 1:16395471-16395493 CCAGTGCCAGCAATAACAGTTTA 0: 1
1: 2
2: 0
3: 8
4: 98
Right 902435441 1:16395489-16395511 GTTTATCATGCTCATTAATTTGG 0: 4
1: 0
2: 1
3: 16
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902435439 Original CRISPR TAAACTGTTATTGCTGGCAC TGG (reversed) Exonic
902435439 1:16395471-16395493 TAAACTGTTATTGCTGGCACTGG - Exonic
903298730 1:22363053-22363075 TATACTGTCAATCCTGGCACAGG + Intergenic
905985826 1:42281088-42281110 TAAAGTCTCATTACTGGCACTGG - Intronic
909179491 1:72403802-72403824 TACTCTGTTATGGCTGGAACTGG + Intergenic
916317923 1:163471032-163471054 TAAACTTTTATTGTTGGCCATGG - Intergenic
917918998 1:179733907-179733929 AAAACTGTTATTCCTGGGATAGG - Intergenic
919007362 1:191914731-191914753 TATACTGTTATTACTTGAACAGG - Intergenic
921372344 1:214437078-214437100 AAAAATATTATTTCTGGCACTGG - Intronic
921943503 1:220869040-220869062 TCAACTGTTATTGCAGCCACAGG + Intergenic
922152222 1:223016400-223016422 TGATCTGTTAATGCAGGCACTGG + Intergenic
924277206 1:242400950-242400972 TAAATTTTTATTTCTGGCCCTGG + Intronic
1067554109 10:47255823-47255845 TAAAATGTTACTACTGGCACAGG + Intergenic
1068779660 10:60905750-60905772 TACAATGTTATTTCTGGCCCAGG + Intronic
1071958126 10:90780944-90780966 TAAACGTTTATTCCTTGCACGGG - Intronic
1076991081 11:274942-274964 TGAACTATTTTTGCTTGCACAGG - Intergenic
1080332883 11:31160876-31160898 TCAACATTTATTTCTGGCACTGG + Intronic
1080699958 11:34636438-34636460 TAAACTGTGTTGGCTGGCACTGG - Intronic
1095156762 12:38866039-38866061 AAAACTGGTATTGCTGACATTGG + Intronic
1097376233 12:58846293-58846315 TAAACTGTCATTGCTGCTCCAGG + Intergenic
1099018387 12:77373085-77373107 TGAACAGTTATTTCTGGCTCTGG + Intergenic
1099191896 12:79569740-79569762 GAGACTGTCATTGCTGGAACTGG + Intergenic
1103734600 12:123051639-123051661 TAAATTGTTCGTGCTGGCTCTGG + Intronic
1104031354 12:125067390-125067412 CATTCTGTTATTGCTGGCAGAGG - Intronic
1108819755 13:54334342-54334364 TAAACTGTTCTTGTTGGGTCTGG + Intergenic
1114298219 14:21349714-21349736 TAAACTGGTCTTCCTGCCACCGG + Intronic
1116208454 14:41901491-41901513 TATTCTGTGATTGCTTGCACAGG + Intronic
1116348266 14:43825493-43825515 TAAACTGTTATTTCTTCCAGTGG + Intergenic
1116713622 14:48400004-48400026 TAACTTGTTATTGCTGACATAGG + Intergenic
1117022006 14:51580327-51580349 TAAATTATTATTGCTGATACTGG - Intronic
1118694387 14:68370241-68370263 TAAACTGTAATTTCTGCCAATGG - Intronic
1119943859 14:78670549-78670571 TTAACTGCTATTGCTGTCAGAGG - Intronic
1120009669 14:79399287-79399309 TACACTTTTATTGCTGACACTGG + Intronic
1120081671 14:80224671-80224693 TAATCTGTTATAGCAGCCACAGG + Intronic
1120594736 14:86419641-86419663 TAAGCTGCTATTGCTGGAAATGG - Intergenic
1120833942 14:89023692-89023714 GAAACTGTTGTTGCTATCACAGG + Intergenic
1129062610 15:72872359-72872381 TAAATTGTTATGGCAGCCACAGG + Intergenic
1129980915 15:79869768-79869790 TAAAATGTTAATGATGGCAAAGG + Intronic
1135609763 16:23856085-23856107 TAGACTGTACTTGCTGGCACTGG + Intronic
1136665811 16:31811319-31811341 TGTACTGTCATTGCTGCCACAGG - Intergenic
1138826417 16:60325946-60325968 TAAAATGTCATTGGTGGCTCTGG + Intergenic
1139273983 16:65709926-65709948 GAAGATGTTATTTCTGGCACAGG - Intergenic
1140328895 16:74033103-74033125 TTAACTGTTAATGCCAGCACAGG + Intergenic
1153194401 18:2577889-2577911 TAAACTGTGATTGTTGTCATAGG + Intronic
1156101352 18:33599437-33599459 CAAACTGTTGTGGCTGCCACTGG - Intronic
1159717237 18:71840462-71840484 AAAATTGTGATTGCTGTCACTGG + Intergenic
1166447857 19:42874016-42874038 GAAACAGTTATAGGTGGCACAGG + Intronic
1167101694 19:47407635-47407657 TAACCTCTAATTGCTGGAACAGG - Intronic
1167198657 19:48048752-48048774 AAAGCTGTTATTGCTGGATCAGG - Intronic
925273544 2:2632741-2632763 CAAACTGTTATTTCTTTCACTGG - Intergenic
937535112 2:122876711-122876733 TAAAATGATGATGCTGGCACAGG - Intergenic
940895589 2:159079741-159079763 TAAACTGTTATTGCGGGCACTGG - Intronic
941435983 2:165473366-165473388 TAACCTCTTATTGCTGGAAATGG + Intronic
1169145787 20:3251596-3251618 CAAAGTGTTGTTGCTGGCCCTGG - Exonic
1171444434 20:25193946-25193968 TAAAATCTTTTTGCTGGCATGGG - Intergenic
1173106190 20:40136878-40136900 AAAACTGATATTTCTGACACTGG + Intergenic
1175014412 20:55773847-55773869 TAAACTTTTTTTGGTTGCACAGG + Intergenic
1177842911 21:26254529-26254551 TATAATGTTGTTGCTGGTACAGG + Intergenic
950840966 3:15967985-15968007 TCAACTGTTAATGGTGGGACTGG - Intergenic
951351934 3:21617090-21617112 GAAATTGTTATTGATGTCACAGG - Intronic
951811783 3:26708682-26708704 TATACTGTTAGTGTTGGCAGGGG - Intronic
954260750 3:49436953-49436975 TAAACGGGTATTGCTGGGCCGGG + Intergenic
958851358 3:99329720-99329742 TAAACTTTTATTGTAGGCTCAGG - Intergenic
960714917 3:120565341-120565363 TCAACTTTTAGGGCTGGCACTGG + Intergenic
962912692 3:139868634-139868656 TGAACTTTTATTGATGGCTCAGG + Intergenic
965044464 3:163557730-163557752 CAAGATGTTATTTCTGGCACTGG - Intergenic
969224666 4:5787660-5787682 TAAAGTGTTATAGCAGCCACAGG + Intronic
970847540 4:20559133-20559155 TCAACTGTTTTTGGTGGCCCTGG - Intronic
975450597 4:74520624-74520646 TAAAATATTATTGCTGTCAAAGG - Intergenic
976144938 4:82033002-82033024 TAAGCTATTTTTCCTGGCACAGG + Intronic
977215485 4:94278594-94278616 TAAACTGTTTTTTCTGTCTCAGG + Exonic
979110230 4:116744353-116744375 ACAACTGTTATTGCTGCCTCAGG - Intergenic
979535572 4:121816253-121816275 TAAACTCTTATTTCTGGGGCTGG - Intronic
980079818 4:128332282-128332304 GAAAGAGTTATTTCTGGCACTGG + Intergenic
983975149 4:173924986-173925008 TGAACTGTAAATGCTGACACTGG - Intergenic
986277386 5:6289456-6289478 TAAACTGTCAATTCTGGCAGTGG - Intergenic
986479759 5:8174846-8174868 TAAACTGTGTTTGTTAGCACTGG - Intergenic
989175837 5:38524917-38524939 TAAACTGTTTTATTTGGCACAGG - Intronic
994129214 5:96205322-96205344 TAAACTTTTATTTCAGGCTCAGG + Intergenic
994367866 5:98935881-98935903 CAAACTGTTATTGCTGGTAAGGG + Intergenic
995913636 5:117217047-117217069 TAAAATGTTAGTGCTGGAATGGG - Intergenic
996708933 5:126524974-126524996 TAAACAGTTATTGTTGGACCAGG + Intergenic
997340769 5:133142768-133142790 TAAACTGGGAGTGATGGCACAGG - Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
1001224012 5:169928233-169928255 TCTACAGTTATTGCTGCCACAGG + Intronic
1006445849 6:34079377-34079399 TAAACTGTTGTTGCAGGGATGGG - Intronic
1008240597 6:49106180-49106202 TAATCTGTTAATGCTGACAGTGG - Intergenic
1011351929 6:86433042-86433064 TAAACTGTTATTGGTGGCACTGG - Intergenic
1013442821 6:110188787-110188809 TAAACTGCTATGGCTACCACTGG - Intronic
1013598383 6:111681690-111681712 TAAACTGTTGTTTCTAGCACTGG - Intronic
1014757060 6:125313020-125313042 TGAAGTGGTATTGCTGTCACAGG - Intergenic
1015139457 6:129913207-129913229 TAAACTCTTCTTTCTGGGACGGG - Intergenic
1017702599 6:157090094-157090116 TAAACTGGAATGGCTGGCTCTGG - Intronic
1020136598 7:5591610-5591632 TAAACTGGGATTGCTGGGGCTGG - Intergenic
1023596168 7:41831220-41831242 TAATTTGTTATTGCTGCCCCTGG + Intergenic
1028621073 7:92830275-92830297 TGACTTGTTATTGCTGGCACTGG - Intronic
1029465691 7:100723262-100723284 TGAGATGTCATTGCTGGCACTGG - Exonic
1043688639 8:83121732-83121754 CAAACTGTTATTGCTTGAATAGG + Intergenic
1047290354 8:123524379-123524401 TAAACTGTTAGTGATTTCACAGG - Intronic
1050882381 9:10718947-10718969 CAACCTGTTATAGCTGGCCCAGG - Intergenic
1052526762 9:29628798-29628820 TAAACTGATATTGCAGAAACTGG + Intergenic
1053594910 9:39550510-39550532 TAAACTGTGATTTGTGGAACAGG + Intergenic
1054571344 9:66814458-66814480 TAAACTGTGATTTGTGGAACAGG - Intergenic
1057042677 9:91858816-91858838 TAAGCTGGAGTTGCTGGCACTGG - Intronic
1058327301 9:103714949-103714971 TAAACTGTAATTGTTGGTAGAGG + Intergenic
1060080700 9:120641676-120641698 TAAACTGATATTGCTGGTCTGGG + Intronic
1060536510 9:124393358-124393380 TAAACTGTTTATGCTGACAAAGG - Intronic
1061960734 9:133987709-133987731 CAAACTGCTGATGCTGGCACAGG + Intronic
1189520497 X:41762390-41762412 TAAACTCTTATTGCTAGCCTAGG + Intronic
1189932480 X:46028765-46028787 GAATCTGTTATTTCTGGCTCAGG + Intergenic