ID: 902439677

View in Genome Browser
Species Human (GRCh38)
Location 1:16421369-16421391
Sequence ACAGCCACACACACCTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 460}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902439676_902439677 -5 Left 902439676 1:16421351-16421373 CCATGTGCACTTTAACACACAGC 0: 1
1: 0
2: 0
3: 11
4: 166
Right 902439677 1:16421369-16421391 ACAGCCACACACACCTTCCTTGG 0: 1
1: 0
2: 1
3: 42
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902439677 Original CRISPR ACAGCCACACACACCTTCCT TGG Intronic
900625274 1:3605202-3605224 ACAGTCACACACACTTTACATGG + Intronic
900726980 1:4222970-4222992 CAGGCTACACACACCTTCCTGGG - Intergenic
901777661 1:11571285-11571307 ACTGCCACACACAATTTTCTGGG + Intergenic
901822628 1:11840006-11840028 ACAGCCAGACACAGCTTGATTGG - Intronic
901921100 1:12538262-12538284 ACAGCTGCACACACCATCCATGG + Intergenic
902385407 1:16073120-16073142 ACAGCCACACACCCCCTGCCGGG - Intronic
902402457 1:16165727-16165749 ACACACACACACACCTTTCCAGG + Intergenic
902439677 1:16421369-16421391 ACAGCCACACACACCTTCCTTGG + Intronic
902541655 1:17159877-17159899 CGTGCCACATACACCTTCCTTGG - Intergenic
904163324 1:28536891-28536913 GCAGCCCCACTCACCATCCTTGG - Exonic
904239116 1:29132619-29132641 CCAGCCAAACACACATTTCTTGG - Intergenic
904308903 1:29612508-29612530 ACAGCAGCTCACACCTGCCTTGG - Intergenic
904438157 1:30512716-30512738 CCAGCCACCCACACCCTCCCTGG + Intergenic
904452312 1:30621666-30621688 ACAGACACACACACACTACTGGG - Intergenic
905110246 1:35589611-35589633 AGGGCCACACACACCTACCAGGG - Intronic
905352779 1:37359109-37359131 ACACACACACACACAATCCTGGG - Intergenic
905869608 1:41395508-41395530 ACACACACACACACACTCCTGGG - Intergenic
906086000 1:43135320-43135342 ACAACCACACACACCAGTCTGGG - Intergenic
907094294 1:51762306-51762328 ACAGGCACACACACCACACTTGG + Intronic
907616105 1:55928480-55928502 GCAGACACACACACATTGCTAGG - Intergenic
907617254 1:55937932-55937954 ACAGCTGCTCACACCTTCCCAGG + Intergenic
908519166 1:64924757-64924779 AAAGCCACAAACACCTTTATAGG + Intronic
909103610 1:71381299-71381321 ACAGCCTGACACACCATCTTAGG - Intergenic
909635228 1:77810354-77810376 ACATCCAGACAGACCTTCTTAGG + Intronic
909919026 1:81357115-81357137 ACAGCAAGACACATCATCCTGGG + Intronic
910909576 1:92218829-92218851 AAAGCCACACAGTCCTTGCTTGG + Intronic
911104714 1:94120763-94120785 ACAGAGAAACACATCTTCCTGGG + Intronic
911199110 1:95026455-95026477 ACACACACACACACATTCCTTGG - Intronic
911356890 1:96833668-96833690 ACACACATACACACCTTCTTTGG + Intergenic
913255426 1:116949209-116949231 TCAGCCACAGACACATTCTTGGG - Exonic
913435435 1:118842687-118842709 ACACCCACTCACTCCTTCCCAGG + Intergenic
915284767 1:154845688-154845710 ACACACACACACACTTCCCTAGG + Intronic
915343017 1:155186460-155186482 ACACACACACACACCTCCTTAGG - Intronic
918226078 1:182484534-182484556 AAAGCTTCACACGCCTTCCTGGG - Intronic
918576163 1:186063027-186063049 ACACACACACACACATTCCATGG - Intronic
919270213 1:195331991-195332013 TTAGCCACACTCACCTTCATGGG + Intergenic
920194851 1:204220034-204220056 ACAGACACATACAAGTTCCTTGG - Exonic
921175455 1:212589604-212589626 ACTGCCACCTCCACCTTCCTGGG - Intronic
921325958 1:213986498-213986520 ACACACACACACTCCTTCCTAGG - Intronic
922121080 1:222669384-222669406 ACATCCAGACAGACCTTCTTAGG + Exonic
924448884 1:244159849-244159871 GGAGTCACACACACCTGCCTTGG - Intergenic
1062794831 10:336821-336843 ACACACACACACAGCTGCCTAGG - Intronic
1062794840 10:336887-336909 ACACACACACACACCTGCCTAGG - Intronic
1062794848 10:336969-336991 ACACACACACACAGCTGCCTAGG - Intronic
1062794852 10:337002-337024 ACACACACACACAGCTGCCTAGG - Intronic
1062794864 10:337121-337143 ACACACACACACAGCTGCCTAGG - Intronic
1062794888 10:337292-337314 ACACACACACACAGCTGCCTAGG - Intronic
1062794950 10:337881-337903 ACACACACACACAGCTTCCTAGG - Intronic
1063290109 10:4736248-4736270 ACACACACACACACCATCCTTGG - Intergenic
1064658608 10:17582493-17582515 ACACACACACACCCCTTCTTAGG - Intergenic
1065006863 10:21388182-21388204 ACAGCTACAAATACCTTCCAGGG - Intergenic
1065656367 10:27955688-27955710 ACACACACACACACCTTAATTGG - Intronic
1067131305 10:43567930-43567952 ACAGCTCCGCACAGCTTCCTGGG + Exonic
1067159660 10:43814154-43814176 ACATGCACACACACCTGCCTAGG + Intergenic
1067975534 10:51021015-51021037 ACAGACACACACCCCTACATAGG - Intronic
1068572207 10:58642581-58642603 ACAGTCAACCACACTTTCCTGGG - Intronic
1069153889 10:65000622-65000644 AAATCCACACACTGCTTCCTGGG - Intergenic
1069795451 10:71049039-71049061 ACAGCCATACACACTTTGCAAGG + Intergenic
1070726511 10:78795209-78795231 TCTGCCTCACACAGCTTCCTAGG + Intergenic
1072533286 10:96339594-96339616 ACAGGCACACACACCATCTGAGG - Intergenic
1073093435 10:100965082-100965104 ACACACACACACACATTCATAGG - Intronic
1073572043 10:104589019-104589041 ACAGTCACACTCACTTCCCTCGG - Intergenic
1074597463 10:114880699-114880721 ACACACACACACAGATTCCTGGG + Intronic
1075897134 10:126006464-126006486 ACAGCCACACACTCCTTGATTGG + Intronic
1076686843 10:132202021-132202043 ACAGCCACTCGCCCCTTCCTTGG - Exonic
1076941761 10:133614806-133614828 ACAGCCAAAAACACCTGCCCTGG - Intergenic
1077372341 11:2189068-2189090 GCAGTCACACACACGTTCCTGGG - Intergenic
1077419018 11:2440875-2440897 GCAGCCACACACCCTTCCCTTGG + Intergenic
1077900498 11:6483584-6483606 ACACCAACACACACCTTTATGGG + Exonic
1078347825 11:10566475-10566497 ACAGACACACACACACCCCTAGG + Intronic
1078901658 11:15648276-15648298 TCATCCACACAGGCCTTCCTAGG + Intergenic
1079211157 11:18461774-18461796 ACTGCAACCCACACCTTCCCGGG - Intronic
1079330363 11:19527958-19527980 ACACACACACACACAATCCTGGG + Intronic
1080763618 11:35276004-35276026 ACAGCTACACACATTTTCCCAGG + Intronic
1080892982 11:36425662-36425684 ACACCCACACACACCAACATTGG + Intronic
1081404615 11:42682352-42682374 ACACACACACACACAATCCTAGG + Intergenic
1081564430 11:44248752-44248774 ACAGACCCACACACCCTCCCAGG - Intergenic
1081931889 11:46877185-46877207 AGGGCCATACAGACCTTCCTGGG + Exonic
1082652317 11:55808422-55808444 ACAGTCACACACAGATTCCCTGG - Intergenic
1083336244 11:61923498-61923520 GCAGCCACGCACACCTGGCTGGG + Intergenic
1083640700 11:64143790-64143812 ACACACACACACAATTTCCTGGG + Intronic
1083708016 11:64529922-64529944 ACAGCCCCACACCCCTCTCTCGG - Intergenic
1084492813 11:69487682-69487704 ACACCCACCCACACCTGCCTGGG - Intergenic
1084637042 11:70399122-70399144 CCCCCCACACCCACCTTCCTTGG - Intronic
1085390248 11:76178623-76178645 ACAGCCCCACACCTCTGCCTGGG - Intergenic
1085456663 11:76669338-76669360 ACACACACACACACATTCTTTGG - Intronic
1086140659 11:83495216-83495238 ACAGACACACACATCTACCACGG - Intronic
1086644972 11:89209186-89209208 ACAGTCACTCACAGCTTCCTTGG - Intronic
1088838491 11:113601995-113602017 ACACACACACACACCTTTTTTGG + Intergenic
1089332344 11:117698815-117698837 ACAGCCCCACACATATTCCCAGG + Intronic
1090214180 11:124946339-124946361 ACAGCCAAAAAGCCCTTCCTTGG + Intergenic
1090343720 11:126049415-126049437 ACAGCCTCACACCTCTTACTGGG + Intronic
1090383563 11:126343613-126343635 TCACCCTCACACGCCTTCCTCGG + Intronic
1090669701 11:128937677-128937699 TCAGACACACACACCTGGCTGGG - Exonic
1093089225 12:14903088-14903110 ACACACACACACACTTTCTTAGG + Intronic
1093452184 12:19328552-19328574 ACACACACACACACACTCCTAGG - Intronic
1094375580 12:29784294-29784316 ACCCCCACACCCACCTTCCAGGG + Intronic
1094414206 12:30201100-30201122 ACCCCCACACCCACCTTCCAGGG - Intergenic
1095596064 12:43959682-43959704 ACACACAAACACTCCTTCCTTGG - Intronic
1096087225 12:48873840-48873862 ACAGGCACACACACCATGCCCGG - Intergenic
1096110250 12:49024535-49024557 ACACCCACACCCACATCCCTTGG + Intronic
1096597229 12:52703555-52703577 ACACACACACACACATTACTGGG + Intergenic
1096878019 12:54645486-54645508 ACAGCTACACCCATATTCCTAGG - Intronic
1097875957 12:64643455-64643477 ACAGCCCCAAACTCCTTCCTCGG - Intronic
1098598445 12:72300386-72300408 ACACACACACACACATTGCTGGG + Intronic
1098953562 12:76666056-76666078 ACACACACACACACTTTCCTGGG - Intergenic
1100104010 12:91146496-91146518 ACAGGCACACACACCATGCCCGG + Intronic
1100719501 12:97342748-97342770 ACAGCCACATACACACACCTGGG - Intergenic
1101179914 12:102204785-102204807 ACACACACACACACCTTCTAAGG - Intergenic
1101253100 12:102954387-102954409 CCTGCCACACACCCTTTCCTGGG + Intronic
1101505634 12:105343870-105343892 ACAGACACACACACACTTCTTGG + Intronic
1102587515 12:113933499-113933521 ACAGACACGCACAACTTCCCGGG + Intronic
1102615377 12:114149548-114149570 CCTGCCTCACACACCTTCCCAGG - Intergenic
1102695844 12:114798770-114798792 ACACACACACACACCTGCCCGGG - Intergenic
1103009214 12:117445058-117445080 ACAGCCTCTCACACAGTCCTGGG + Intronic
1103212944 12:119179595-119179617 ACATTCACACACACTTTCCAGGG - Exonic
1103918627 12:124388442-124388464 ACAGCATCACAGACCTTCCCAGG + Intronic
1104424646 12:128665691-128665713 ACAGGCACACACACATTCACAGG + Intronic
1104424653 12:128665787-128665809 ACAGGCACACACACATTCACAGG + Intronic
1104424654 12:128665805-128665827 ACAGGCACACACACATTCACAGG + Intronic
1104424659 12:128665889-128665911 ACAGCCACACACACATTCACAGG + Intronic
1104424661 12:128665907-128665929 ACAGGCACACACACATTCACAGG + Intronic
1104424670 12:128666001-128666023 ACAGGCACACACACATTCACAGG + Intronic
1104424681 12:128666129-128666151 ACAGGCACACACACATTCACAGG + Intronic
1104424690 12:128666225-128666247 ACAGGCACACACACATTCACAGG + Intronic
1107193194 13:37614936-37614958 ACACACACACACACGATCCTTGG - Intergenic
1108317929 13:49256197-49256219 ACACTCCCACACACCTTGCTGGG + Intronic
1108744423 13:53377027-53377049 CCACCCACACACACCCTCCACGG - Intergenic
1109090703 13:58041116-58041138 ACACACACACACACTTTTCTTGG - Intergenic
1110351415 13:74512786-74512808 ACAACCACAAAAATCTTCCTGGG + Intergenic
1110410684 13:75201144-75201166 ACAGCCCTACCCACCTCCCTTGG + Intergenic
1110580611 13:77119755-77119777 ATAGCCACACGCTCCATCCTGGG - Intronic
1112139675 13:96624760-96624782 CCAACCACACACACCATCATGGG - Intronic
1112171973 13:96983267-96983289 TCAGACACAAGCACCTTCCTAGG + Intergenic
1112582267 13:100686645-100686667 ACAGACTAACACACCATCCTTGG + Intergenic
1113647250 13:112007392-112007414 ACATCCCCACCCACCATCCTGGG + Intergenic
1113662939 13:112119407-112119429 ACAGCAACACACACATGGCTGGG + Intergenic
1113662947 13:112119486-112119508 ACAGTGACACACACATGCCTGGG + Intergenic
1113662956 13:112119567-112119589 ACAGCAACACACACATGGCTGGG + Intergenic
1113729220 13:112627546-112627568 ACACACACACACAACTTCCAGGG - Intergenic
1114181560 14:20372353-20372375 ACACACACACACATATTCCTGGG - Intronic
1114861388 14:26527685-26527707 ACAGCAGTAGACACCTTCCTAGG + Intronic
1116181624 14:41543064-41543086 ACAGCAACACTCTCCTGCCTGGG - Intergenic
1116317007 14:43410288-43410310 ACAGACACACACACATACCATGG - Intergenic
1117872942 14:60219710-60219732 ACCTCCACACACACCTTAATTGG + Intergenic
1118409297 14:65460990-65461012 ACACACACACACAGCTTTCTAGG - Intronic
1118744002 14:68761198-68761220 ACTAGCACACACACCTTCATTGG - Intergenic
1118834711 14:69469218-69469240 AGAGCCACTCACCCCTTCCCAGG + Intergenic
1119411251 14:74432132-74432154 ACACACACACACACCTTCCAAGG - Intergenic
1120220866 14:81731160-81731182 ACAGCCAAATACACCTACATAGG - Intergenic
1121229260 14:92344626-92344648 ACAGCCTCAAACACCTCCCCAGG - Intronic
1121513191 14:94529184-94529206 ACAGCCTGACACACCTTTCCTGG - Intergenic
1121625775 14:95384570-95384592 TCAGCCCCACCCTCCTTCCTTGG + Intergenic
1121656961 14:95604260-95604282 ACAGCCTGACACAACCTCCTGGG + Intergenic
1122488276 14:102095992-102096014 CCTGCAACACACACCTTCCTTGG + Intronic
1124707353 15:31977025-31977047 ACAGCCACACAAACCATGCTGGG - Intergenic
1126032427 15:44512592-44512614 AAAACCACACACACCTTCTTTGG - Intronic
1126478070 15:49088257-49088279 ACAGCCACTCAGATCTGCCTGGG + Intergenic
1126851057 15:52797283-52797305 ACAGCCACCAGCACCTCCCTAGG + Intergenic
1127244375 15:57155651-57155673 ACAGGCACACACACCCACATAGG - Intronic
1128957734 15:71966257-71966279 ACACACACACACACTTGCCTGGG - Intronic
1129057033 15:72827345-72827367 ACAGCCTCACTCACCTGCTTAGG - Intergenic
1129654089 15:77511289-77511311 AAATACACACACACATTCCTTGG + Intergenic
1130101907 15:80900575-80900597 ACACACACACACCCCTACCTGGG - Intronic
1132950370 16:2558614-2558636 ACAACCACACACGGCTTCATGGG - Intronic
1132963978 16:2641556-2641578 ACAACCACACACGGCTTCATGGG + Intergenic
1133533392 16:6676168-6676190 ACACACACACACACTTCCCTAGG + Intronic
1133738288 16:8632140-8632162 TCGGCCACACTCAGCTTCCTGGG + Intronic
1133806453 16:9128940-9128962 ACAGGCACAAACACGTCCCTTGG - Intergenic
1134264847 16:12684081-12684103 GCAGCCACACACAGCTGCATGGG + Intronic
1134372109 16:13635447-13635469 ACACACACACACACATTCCTGGG + Intergenic
1134562216 16:15220339-15220361 ACAATCACACCCACCTTACTGGG + Intergenic
1134913009 16:18045455-18045477 ACAGCCACACAGATCAACCTAGG - Intergenic
1134922753 16:18131965-18131987 ACAATCACACCCACCTTACTGGG + Intergenic
1136528907 16:30853308-30853330 ACACACACACACACCAGCCTAGG + Intronic
1136682964 16:31978626-31978648 ACAGCCCCACACCACTGCCTTGG - Intergenic
1136926956 16:34383152-34383174 ACAACCCCACACACCCTCCCAGG + Intergenic
1136935314 16:34457482-34457504 ACACCCACACACACCATTATTGG - Intergenic
1136964504 16:34891098-34891120 ACACCCACACACACCATTATTGG + Intergenic
1136977618 16:35028655-35028677 ACAACCCCACACACCCTCCCAGG - Intergenic
1137690300 16:50421940-50421962 AAGGTCACACACAACTTCCTGGG + Intergenic
1138607636 16:58099089-58099111 ACAGCCACGTGCACCTTCCTAGG - Intergenic
1138810268 16:60140804-60140826 ACACACACACACACATTCATCGG + Intergenic
1139056155 16:63187512-63187534 ACACACACACACACACTCCTGGG + Intergenic
1139474824 16:67197920-67197942 ACACCCACTCCCACCTTCCAGGG - Intronic
1140021735 16:71245555-71245577 ACATCCACACACACACTTCTGGG + Intergenic
1140571993 16:76118450-76118472 ACATGCACACACACACTCCTAGG + Intergenic
1141000086 16:80299716-80299738 ACAGCCACACACACAGCCATGGG - Intergenic
1141205724 16:81931847-81931869 ACAACCAGACCCACCTTCCCAGG - Intronic
1141459657 16:84170380-84170402 ACAGACACACACACCTCTCAGGG + Intronic
1144125037 17:12195383-12195405 ACACCTACACACACATACCTAGG - Intergenic
1144695285 17:17300186-17300208 ACACACACACAAAACTTCCTTGG - Intergenic
1144710594 17:17399203-17399225 ACAGCCACCCACCCGATCCTAGG + Intergenic
1145224494 17:21116722-21116744 ACACACACACACACCTTATTTGG + Intergenic
1145751816 17:27360806-27360828 ACACCCACACACACGTACTTAGG - Intergenic
1146535913 17:33651975-33651997 ACATGCACACACTCCTTTCTGGG - Intronic
1147018742 17:37513668-37513690 ACAGGCAGACACACCGTCCCCGG + Intergenic
1147877807 17:43633901-43633923 ACACACACACACACCATCTTTGG - Intergenic
1148127403 17:45243969-45243991 ATGACCACACTCACCTTCCTGGG + Exonic
1148749288 17:49935442-49935464 ACACACAGACACACCTTCCCAGG - Intergenic
1149185911 17:53997586-53997608 CCAGCCACACTGACCTTCTTAGG + Intergenic
1152502613 17:80722814-80722836 CCAACCACACACAGCCTCCTTGG + Intronic
1153861823 18:9218808-9218830 ACAGGCACGCACACCATGCTAGG + Intronic
1154341182 18:13503660-13503682 ACATCCACGCACACATGCCTGGG - Intronic
1155117584 18:22784396-22784418 ACAATCACTCACACCTCCCTTGG + Intergenic
1156646987 18:39175732-39175754 ACAGGCATACACACCTGCCTTGG + Intergenic
1157130284 18:45000810-45000832 ACACACACACACACACTCCTAGG + Intronic
1157685747 18:49640997-49641019 CCAGCCACACCCACCTCCCCAGG - Intergenic
1157852808 18:51073421-51073443 ACACACACACACACCATACTTGG + Intronic
1157907426 18:51581836-51581858 ACATACACACACACATTCCTTGG - Intergenic
1158219800 18:55138875-55138897 ACACACACACACACATTCTTAGG - Intergenic
1159874622 18:73796519-73796541 ACACACACACACATCTACCTTGG - Intergenic
1160158964 18:76456598-76456620 TGAGCCACACACACATTCCCGGG - Intronic
1160363732 18:78306661-78306683 AGAACCACTCACAGCTTCCTGGG + Intergenic
1160509063 18:79443297-79443319 ACTGTCACACACACTTGCCTCGG + Intronic
1160624329 18:80192599-80192621 ACAGCCCCACACAGGTCCCTGGG - Intronic
1160728739 19:630701-630723 GCTGCCACACACACACTCCTAGG + Intronic
1160879384 19:1312659-1312681 ACAGGCACACACCCCCTCCCAGG - Intergenic
1161768716 19:6220184-6220206 ACAGCCACACACAGCCTCTGGGG + Intronic
1161773252 19:6242723-6242745 ACAGCCACACTCCCCTTTCCTGG + Intronic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1163114073 19:15178805-15178827 GCCGCCACCCACACCTACCTGGG + Exonic
1163707852 19:18826643-18826665 ACAGGCACACACACCATGCCCGG - Intergenic
1164578604 19:29420637-29420659 ACACTCACACACACCTCCCCCGG + Intergenic
1164578622 19:29420735-29420757 ACACTCACACACACCTCCCCCGG + Intergenic
1164578633 19:29420784-29420806 ACACTCACACACACCTCCCCCGG + Intergenic
1164578654 19:29420870-29420892 ACACTCACACACACCTCCCCCGG + Intergenic
1164578664 19:29420919-29420941 ACACTCACACGCACCTTCCCCGG + Intergenic
1165076034 19:33280503-33280525 ACACACACACACACCTGGCTTGG + Intergenic
1165954216 19:39491745-39491767 ACAGCCACGCACGACCTCCTTGG - Intronic
1166089183 19:40497267-40497289 ACATGCACACACACATTCCCGGG + Intronic
1167762187 19:51456964-51456986 TCCTCCACACACCCCTTCCTTGG - Intronic
924997920 2:380976-380998 ACACACACACACACCCTCCAAGG + Intergenic
925049021 2:796708-796730 AAAGGCAAGCACACCTTCCTGGG - Intergenic
925529736 2:4845929-4845951 ACAGTCACAGCCAGCTTCCTTGG + Intergenic
926694873 2:15764193-15764215 AAAGGTACACACTCCTTCCTAGG - Intergenic
927147710 2:20177915-20177937 CCAGCCACTCTCACCTTCCAGGG - Intergenic
927187261 2:20490744-20490766 CCACCCACACACACATACCTCGG - Intergenic
927991392 2:27449908-27449930 CCCACCTCACACACCTTCCTGGG + Intronic
930222646 2:48760840-48760862 CCAGCCACCCACACCATCCGTGG - Intronic
930513827 2:52380654-52380676 ACAGCCTGACAAACCTTCCCTGG - Intergenic
930557056 2:52910491-52910513 ACATCCACACAAACCTTCTTTGG - Intergenic
931122745 2:59238463-59238485 ACAGCCACACAGTCCTTTCTTGG + Intergenic
931184444 2:59936452-59936474 ACACACACACACTCCTTCCTAGG - Intergenic
931980499 2:67688914-67688936 ACAGACTCACAAACCTTCCCTGG - Intergenic
932292487 2:70594195-70594217 ACAGCACCTGACACCTTCCTAGG - Intergenic
932400808 2:71479818-71479840 CCAGCCACATAGAGCTTCCTTGG + Intronic
933976300 2:87514779-87514801 ACCGCCACCCAGGCCTTCCTTGG - Intergenic
934332164 2:92079007-92079029 ACACACACACACACCATCATTGG + Intergenic
935460004 2:103319050-103319072 ACTGCCTAACACATCTTCCTTGG + Intergenic
935600025 2:104913232-104913254 GCAGTAACACACACATTCCTTGG + Intergenic
935671336 2:105559627-105559649 CCCTCCATACACACCTTCCTTGG + Intergenic
935839940 2:107098275-107098297 AGAGCCTCACACACCTTCTAAGG + Intergenic
936317522 2:111436027-111436049 ACCGCCACCCAGGCCTTCCTTGG + Intergenic
936432879 2:112480359-112480381 ACACACACACACACGTTCCAAGG + Intergenic
936729264 2:115360867-115360889 ACAGCAACACTGCCCTTCCTGGG - Intronic
936960394 2:118067426-118067448 ACAAACACACACACCAACCTAGG - Intergenic
937145527 2:119641025-119641047 ACATCCACCCACACCTCCCCAGG + Intronic
937173645 2:119903571-119903593 ACACACACACACACCTTTCAGGG + Intronic
937829876 2:126407895-126407917 ACACACACACACACCTCTCTTGG - Intergenic
938210479 2:129462588-129462610 TGAGCCTCACACACCTGCCTAGG - Intergenic
939704267 2:145432502-145432524 ACACACACACACACTTCCCTGGG + Intergenic
939713329 2:145551548-145551570 ACAACCACACAGAGCTTCTTCGG + Intergenic
939750280 2:146035724-146035746 TCAGGAACACACACTTTCCTAGG + Intergenic
940931656 2:159439625-159439647 CATGCCACACACACCTTTCTGGG + Intronic
940951742 2:159682914-159682936 CCCCCCACACACACCTTTCTAGG + Intergenic
941889136 2:170559905-170559927 ACAAACACACACACATTCTTAGG - Intronic
942466434 2:176212344-176212366 ACAGATACCCACTCCTTCCTTGG - Intergenic
942705878 2:178771404-178771426 ACATTCAAACACAGCTTCCTGGG + Exonic
943373278 2:187043750-187043772 ACACACACACACACCTTGCATGG - Intergenic
943398606 2:187374854-187374876 ACACACACACACACATCCCTGGG + Intronic
944422259 2:199544073-199544095 ACAGTCAGAAACTCCTTCCTGGG - Intergenic
944435249 2:199681900-199681922 ACACACACACACACACTCCTTGG - Intergenic
944486700 2:200214200-200214222 ACACACACACACACACTCCTGGG + Intergenic
946193988 2:218022510-218022532 ACAGGCACACACGGCCTCCTGGG + Intergenic
946406178 2:219493141-219493163 CCAGCCATGCCCACCTTCCTTGG - Exonic
947298827 2:228665408-228665430 ACAACCACCCACAGCATCCTGGG - Intergenic
948050471 2:234976086-234976108 ACAACCACACACATCATCCCTGG - Intronic
948313411 2:237007778-237007800 CCAGCCACACACACATCCCAAGG - Intergenic
948877565 2:240837773-240837795 AATGCCACCCACACCTCCCTTGG + Intergenic
949029533 2:241785864-241785886 ACACACACACACACATCCCTTGG + Intronic
1170147644 20:13194536-13194558 ACACACACACACACATTTCTTGG - Intergenic
1170476344 20:16718621-16718643 ATAGTCACAAAGACCTTCCTAGG - Intergenic
1171005190 20:21457826-21457848 ACACACACACACATCTTCTTGGG - Intergenic
1171296156 20:24018982-24019004 ACAGCCACACCCACATTCCCTGG + Intergenic
1171474459 20:25397449-25397471 ACTTTCACACACAACTTCCTGGG - Intergenic
1172329724 20:34066926-34066948 TCAGCCACACACGCTCTCCTTGG - Intronic
1172434523 20:34919568-34919590 ACACACACACACACTTGCCTTGG - Exonic
1172690569 20:36786620-36786642 ACAGTCACAAACAGCGTCCTAGG + Exonic
1172776618 20:37411153-37411175 ACACACACACACACCCTGCTGGG - Intergenic
1173692294 20:44971113-44971135 ACACACACACACATATTCCTTGG + Intronic
1173839005 20:46144818-46144840 CCAGCCACACCCACCTTCTGAGG - Intergenic
1174056391 20:47801056-47801078 ACAGTCACATACACATTCATAGG - Intergenic
1174148877 20:48472136-48472158 ACAGCCACCAGCTCCTTCCTGGG + Intergenic
1174191862 20:48746467-48746489 ACAGCTACACACAACATCATGGG + Intronic
1174739972 20:53003247-53003269 ACACACACACACACCATCCCTGG - Intronic
1174810104 20:53638204-53638226 ACACACACACACACCTGCCATGG - Intergenic
1175011471 20:55741958-55741980 GCAGACACACACTCCTGCCTGGG + Intergenic
1175728115 20:61333285-61333307 ACATGCACACACACCTGCATGGG + Intronic
1175999753 20:62826542-62826564 ACACCCACACACACGGTCCCAGG + Intronic
1176076790 20:63252265-63252287 CCAGCCCCAAACCCCTTCCTGGG + Intronic
1176112983 20:63418937-63418959 ACAGCCACCTCCACCTTGCTGGG + Intronic
1176268953 20:64225506-64225528 GCAACCACACACACCTGCCAGGG + Intronic
1176988992 21:15471670-15471692 ACACACACACACACATTCCAAGG + Intergenic
1178431070 21:32519499-32519521 ACACACACACACACCCTCCCAGG + Intergenic
1178663032 21:34522695-34522717 ACATACACACATACCTTGCTGGG - Intronic
1180642430 22:17310060-17310082 GCAGCCAGACCAACCTTCCTTGG + Intergenic
1180735586 22:18014129-18014151 ACACACACACACACATTTCTTGG + Intronic
1180990494 22:19932881-19932903 GCAGCCACCTCCACCTTCCTAGG + Intronic
1181345500 22:22217171-22217193 ACACACACACACACCTGTCTTGG - Intergenic
1181635933 22:24174886-24174908 TAGGCCACACACACCTCCCTGGG + Intronic
1181636121 22:24175639-24175661 CCAGCCAGCCACACCTTCCCTGG - Intronic
1182652194 22:31861101-31861123 GCAGAAACTCACACCTTCCTGGG - Intronic
1182911341 22:33987178-33987200 TCAGCCACATACAACTTCCTGGG + Intergenic
1183075939 22:35426721-35426743 ACAGGCACCCAGCCCTTCCTGGG - Intergenic
1183379175 22:37482270-37482292 CCAGCCACTAACACCTTCCATGG + Intronic
1183513651 22:38250680-38250702 ACATCCCCCCACACCTTGCTTGG - Intronic
1183732007 22:39623555-39623577 ACAGGCACACACACCCTCACAGG - Intronic
1183732011 22:39623605-39623627 ACAGGCACACACACCCTCACAGG - Intronic
949105208 3:195030-195052 ATAGCCACACATAGCTTACTAGG - Intergenic
949350336 3:3119236-3119258 CCAGCCCCACCCACCTTTCTGGG - Intronic
949897310 3:8777806-8777828 ACAGACACACATACTTTCCTAGG - Intronic
950073185 3:10168786-10168808 CCAGCCACACTGACCTCCCTGGG + Intronic
950101028 3:10356944-10356966 TCATACACACACACCCTCCTTGG - Intronic
950438545 3:12994324-12994346 GCACGCACACACACCTTCCGAGG - Intronic
951833008 3:26951195-26951217 TAAACCACACCCACCTTCCTGGG - Intergenic
952538933 3:34345648-34345670 AGAGCTACACAAACCTTCCCTGG - Intergenic
952749650 3:36814999-36815021 ACAGCCCCACAGAGCTTTCTGGG + Intergenic
953935424 3:47037652-47037674 TAAGCCACACTCACCTTCATGGG + Exonic
954298959 3:49689177-49689199 ACAGCCTCGCTCACCTTCCCTGG - Intronic
954934738 3:54316068-54316090 ACACACACACACACCCTGCTAGG - Intronic
955170204 3:56556834-56556856 ACACACACACACACCTTTTTGGG - Intergenic
955338041 3:58103257-58103279 ACACACACACACACCCTCCTTGG - Intronic
955599732 3:60632155-60632177 ACAGCCACAGACATCTTCAGGGG + Intronic
955787654 3:62557035-62557057 ACACACACACACACACTCCTTGG + Intronic
959448568 3:106469980-106470002 ACAGCCTAACACACCTGCTTTGG + Intergenic
959759758 3:109946674-109946696 ACATAGACACACACATTCCTTGG - Intergenic
959884694 3:111486221-111486243 ACACCCACACACACACTTCTGGG + Intronic
960496047 3:118376415-118376437 ACAGACACACACACCTCACATGG - Intergenic
961594691 3:128006934-128006956 ACGGCCTTACACACCTCCCTAGG - Intergenic
961714066 3:128846838-128846860 TCTGCCACGCACCCCTTCCTCGG + Intergenic
963443035 3:145365392-145365414 ACACTCACACACACATACCTAGG - Intergenic
965606222 3:170500052-170500074 ACAGCCACAGAATCATTCCTTGG + Intronic
965961769 3:174437766-174437788 ACAGACACACACACACTCCATGG - Intergenic
966568439 3:181410462-181410484 ACAGGCACACACACCTGGCTAGG + Intergenic
966723526 3:183088024-183088046 CCAGCCACACAAGCCTTCTTCGG - Intronic
966862509 3:184238482-184238504 ACAGCCACACACATACACCTGGG - Intronic
967015516 3:185478346-185478368 GCAGGTACACAAACCTTCCTGGG - Intronic
967072900 3:185977143-185977165 GAAGCCACACACACATTTCTCGG + Intergenic
967785446 3:193488892-193488914 CCATCCACTCCCACCTTCCTGGG - Intronic
968248272 3:197177917-197177939 ACAGACAAACACACCTGCTTGGG + Intronic
968322273 3:197780198-197780220 ACAGGCACACACACCATACTTGG + Intronic
968652301 4:1765059-1765081 AAAGCCAGCCACACCTTCCAAGG - Intergenic
968842644 4:3019016-3019038 ACATACACACACACCCTGCTGGG - Intronic
968943241 4:3650225-3650247 ACTGGCACTCACTCCTTCCTGGG + Intergenic
969185255 4:5469681-5469703 ACAGACACACACACCAGGCTTGG + Intronic
969280787 4:6169594-6169616 ACACACACACACAATTTCCTAGG - Intronic
974254963 4:59440181-59440203 ACACACACACACACATTCATAGG - Intergenic
975689428 4:76949658-76949680 GCAGGCTCACACCCCTTCCTGGG + Intergenic
978966322 4:114746388-114746410 ACACACACACACACCCCCCTAGG + Intergenic
978995476 4:115145610-115145632 TCATCCACACACACCTGGCTCGG - Intergenic
980495481 4:133584628-133584650 ACTGTAACACACACCCTCCTTGG + Intergenic
980539376 4:134174112-134174134 ACATCAACACACATTTTCCTAGG + Intergenic
981124111 4:141086056-141086078 ACACACACACACACCCTTCTAGG + Intronic
981914095 4:150015291-150015313 ACAACCCCACACCCCTTCCCTGG + Intergenic
982667171 4:158279161-158279183 ACATCCAGACAGACCTTCTTAGG - Intergenic
985325925 4:188770163-188770185 ACATACACACACACATTCCATGG - Intergenic
985966987 5:3345035-3345057 CCTGGCACACACACCCTCCTGGG + Intergenic
986149031 5:5110009-5110031 ACATACACACACACCTTTATAGG - Intergenic
988179998 5:27778275-27778297 ACAGCATCCCACACCTTCCCTGG + Intergenic
988452808 5:31360167-31360189 ACACACACACACACCACCCTAGG - Intergenic
988668369 5:33354795-33354817 ACACACACACACACCATTCTCGG + Intergenic
988991050 5:36671306-36671328 TCAGTCACACACCCCTTCCAGGG - Intronic
989682944 5:44050929-44050951 ATAGCCACATACTCCTTTCTTGG - Intergenic
991631093 5:68657000-68657022 ACACACACACACACCTTTCCAGG + Intergenic
992402791 5:76426897-76426919 ACACACACACACACCCTCCATGG - Intronic
994145933 5:96394850-96394872 AGAGCCACACAGACCTCCCCTGG + Exonic
995128939 5:108609465-108609487 TCAGCCACCCACACCTCCCACGG + Intergenic
997253641 5:132410705-132410727 TCCGCCACGCACACCTGCCTCGG - Intronic
997367819 5:133337012-133337034 ACAGCAACACACCCCTGTCTCGG + Intronic
998963324 5:147510751-147510773 ACACACACACACACATTCTTAGG + Intergenic
999113609 5:149142381-149142403 ATGGCCACACACTGCTTCCTAGG - Intronic
999253875 5:150198803-150198825 ACACACACACACACCATCCAGGG - Intronic
999314628 5:150575688-150575710 ACACACACACACGCCTTCCTCGG - Intergenic
999699369 5:154214138-154214160 ACTTCCACCCACACCTTCTTTGG + Intronic
999754418 5:154653708-154653730 ATATTCACACACACCTGCCTGGG - Intergenic
1001015652 5:168138720-168138742 AAAGCCACACACATCATCCATGG + Intronic
1001104617 5:168842680-168842702 ACAGCCAGACACACCTGGGTGGG - Intronic
1001137836 5:169117157-169117179 GCAGGCACACACACCTTTCTTGG - Intronic
1001193887 5:169654399-169654421 ACAGCCATATACAACTTCCAAGG + Exonic
1001303052 5:170551609-170551631 ACACACACACACAGCTACCTTGG - Intronic
1001396223 5:171420929-171420951 ACAGACACACACACATGCCCGGG + Intronic
1001675408 5:173508441-173508463 ACAGACACACACACATATCTTGG + Intergenic
1001735708 5:173997701-173997723 ACACACACACACACCCTCCCAGG - Intronic
1001879533 5:175231312-175231334 ACAGCCAGACACACCTTCTTAGG - Intergenic
1001985837 5:176073941-176073963 ACAGCCAAAAACACCTGCCCTGG - Intronic
1002028705 5:176412991-176413013 ACATCTACACACAGCTGCCTGGG + Intronic
1002231034 5:177764183-177764205 ACAGCCAAAAACACCTGCCCTGG + Intronic
1002671629 5:180872354-180872376 ACACACACACACACCCTCGTTGG - Intergenic
1002778776 6:350591-350613 ACAGCCACACTCCCCTTTCCGGG - Exonic
1002913332 6:1507975-1507997 ACAGGCACACACACCATGCCTGG - Intergenic
1002915658 6:1526043-1526065 ACAGCCCCGCACTGCTTCCTGGG + Intergenic
1003569321 6:7246123-7246145 TGAGTCACTCACACCTTCCTGGG + Intronic
1004045044 6:12015029-12015051 ACAGCTCCTCACACGTTCCTGGG + Intronic
1004118644 6:12797002-12797024 ACACACACACACACACTCCTAGG - Intronic
1004564406 6:16781982-16782004 ACAGCCGCACACAGCCTCCCTGG + Intergenic
1006131147 6:31870254-31870276 ACTGCCACACACACCTGCCAAGG - Intronic
1006790635 6:36698853-36698875 GCACGCACACACACCCTCCTTGG - Intronic
1008091530 6:47298649-47298671 ACAGCCACACCCAACCTCTTAGG + Intronic
1008420014 6:51287743-51287765 ACAGCTTCACATACCTTCTTTGG + Intergenic
1009324064 6:62328414-62328436 ACACACACACACACCTTCCAAGG + Intergenic
1009670343 6:66740793-66740815 ACTACCACACTCCCCTTCCTGGG + Intergenic
1010106212 6:72171394-72171416 ACACACACACACACCTCCATGGG + Intronic
1011558105 6:88589648-88589670 TCATCCACACACACCCTCTTGGG + Intergenic
1011678598 6:89760359-89760381 ACATCCACACACTCTTTCCCCGG + Intronic
1011851242 6:91631628-91631650 ACACATACACACACCTTCTTTGG + Intergenic
1012921259 6:105223122-105223144 ACACCCACACAGACCTACCCAGG + Intergenic
1013447774 6:110248275-110248297 ACAGCCTAACACACATTCCTTGG + Intronic
1014899776 6:126948444-126948466 AGAGACACACACACCTCCCAAGG + Intergenic
1015469674 6:133589903-133589925 ACACACACACACACATACCTAGG + Intergenic
1015985045 6:138876150-138876172 AAAGACTCACACACATTCCTGGG - Intronic
1017036772 6:150274143-150274165 ATAGCCACACACATCTCCCAGGG + Intergenic
1017341645 6:153331070-153331092 CCAGACACACACACCATGCTTGG - Intergenic
1017717106 6:157220684-157220706 GCAGCCTCAAACTCCTTCCTGGG + Intergenic
1018446036 6:163859331-163859353 ACACCCACACACATTTACCTGGG + Intergenic
1018695899 6:166391220-166391242 TCTGACACACACACCTTGCTGGG - Intergenic
1018778163 6:167037900-167037922 ACACCCACACACACACTCTTAGG - Intronic
1018931497 6:168243001-168243023 AGAGCCACACACACACTCCAAGG - Intergenic
1019194726 6:170274502-170274524 CCCACCCCACACACCTTCCTTGG - Intergenic
1022382832 7:29876022-29876044 ACAGCCAGACACCCCTGGCTGGG + Intronic
1022812790 7:33885983-33886005 ACAGCCACAAACATGTTCCCTGG - Intergenic
1024202880 7:47124569-47124591 ACACACACACACACCTTCAGGGG + Intergenic
1024759911 7:52583192-52583214 ACCGCCACACACACATACTTAGG - Intergenic
1024801082 7:53079631-53079653 ACACACACACACACCCTGCTAGG - Intergenic
1025236605 7:57239100-57239122 ACAGTCACAAACACATTCATAGG + Intergenic
1026000299 7:66556069-66556091 ACAGCCACGCACCCCTACGTGGG - Intergenic
1026658571 7:72278626-72278648 ATAGCCAGAAACACCTCCCTGGG + Intronic
1026830930 7:73609661-73609683 ACACACACACACTCCATCCTGGG - Intronic
1026965158 7:74434764-74434786 CCAGCCCCACTCACCTTCCTGGG - Intergenic
1027156480 7:75771945-75771967 ACAGCCACAAGCCCCTTCCCTGG - Exonic
1027729747 7:81856250-81856272 ACACACACACAGACATTCCTAGG + Intergenic
1027967303 7:85028496-85028518 ACAGCCAGAGACACCTACTTAGG + Intronic
1028257324 7:88615509-88615531 CCACCCACACACACCTTTTTGGG - Intergenic
1028624193 7:92859290-92859312 ACAGCCACACACACAGTGCCTGG - Intergenic
1032106899 7:129039515-129039537 ACACCCCCACACTCCATCCTGGG + Intronic
1032232865 7:130090896-130090918 ACAGCCACAGCCACCTTCCCTGG + Intronic
1032271285 7:130409673-130409695 ACAGCCACACACTGATTGCTGGG + Intronic
1032978031 7:137248301-137248323 ACACACACACACACATTCCATGG - Intronic
1033190784 7:139276919-139276941 ACAGGCACACACACCATGCCTGG - Intronic
1033655972 7:143374701-143374723 CCAGCCACACCTACCTGCCTTGG + Intergenic
1033785437 7:144724680-144724702 ACACACACACACATCTTACTAGG - Intronic
1034928525 7:155142144-155142166 ACTGCCAGACGCACTTTCCTAGG + Intergenic
1034990429 7:155544568-155544590 ACAGGCACTCACATCTTCCCTGG + Intergenic
1035174571 7:157040961-157040983 CCAGCCAGAAACACATTCCTAGG + Intergenic
1035245050 7:157557560-157557582 ACACACACACACACTCTCCTGGG + Intronic
1035977961 8:4334306-4334328 ACATCCACAAATACCTTCCCAGG - Intronic
1037079380 8:14765131-14765153 ACAGCCACACCCACAATCCCGGG + Intronic
1037145463 8:15566697-15566719 ACAGCCACAACCAACCTCCTAGG + Intronic
1038581434 8:28752269-28752291 AATGCCACTCACACCCTCCTAGG - Exonic
1039656150 8:39410323-39410345 ACAGCCACTGACACCAACCTAGG - Intergenic
1039942846 8:42106024-42106046 ACAGAGACACACACATTCCCCGG + Intergenic
1041015884 8:53592903-53592925 ACACACACACACACATTCCTTGG + Intergenic
1042847105 8:73179287-73179309 ACACACACACACCCCTACCTGGG - Intergenic
1043424106 8:80131744-80131766 ACAGCCACACACCCCTTTACAGG + Intronic
1043661116 8:82742693-82742715 ACACACACACACACATTCCTTGG + Intergenic
1043661448 8:82747337-82747359 ACAGACATACACACATTCCTTGG + Intergenic
1044826515 8:96203500-96203522 AGAGCCAAACTCACCTCCCTGGG + Intergenic
1045052187 8:98337442-98337464 ACACACACACACACATTTCTGGG + Intergenic
1047553688 8:125905659-125905681 ACATACACACACACCATGCTGGG - Intergenic
1048201526 8:132378249-132378271 ACAGGCAAACCCACCTTGCTTGG - Intronic
1049164430 8:141117539-141117561 ACACACACACACACATCCCTGGG + Intronic
1049402611 8:142436305-142436327 CCAGGCACCCACACCTTCCAAGG + Intergenic
1049588199 8:143441488-143441510 CTAGCCACACCCACCTTCCCGGG - Intronic
1051249753 9:15147579-15147601 ATAGCCACACACATCTACATAGG + Intergenic
1051332669 9:16039563-16039585 ACAGCGCCACCTACCTTCCTGGG - Intronic
1053305359 9:36980887-36980909 ACAGCCCCTCACAGCTTACTAGG + Intronic
1055158920 9:73100322-73100344 ACACACACACACACTTTCTTAGG - Intergenic
1055666013 9:78553827-78553849 ACACACACACACACCCTTCTGGG - Intergenic
1056578972 9:87876599-87876621 CCAGCCACACCCACCGACCTTGG - Intergenic
1057033061 9:91793171-91793193 ACAGACAAGCACATCTTCCTTGG + Intronic
1058614851 9:106815168-106815190 ACACCCACACACACCTGTCATGG + Intergenic
1059346543 9:113632793-113632815 ACAGCCACCCACATGTTTCTTGG + Intergenic
1059735960 9:117099968-117099990 ACAGACACACACACTTTCCCTGG - Intronic
1059902307 9:118941749-118941771 GCACACACACACAGCTTCCTAGG - Intergenic
1061327695 9:129874225-129874247 CCAGCCACACGTGCCTTCCTTGG - Intronic
1061821470 9:133229212-133229234 ACACACACACACACCTGTCTTGG - Intergenic
1061833968 9:133317151-133317173 ACACACACACACACCTGTCTTGG + Intergenic
1062047251 9:134430216-134430238 AGAGCCACACACACCAGACTGGG + Intronic
1062195035 9:135268308-135268330 CCAGCCACACAGAGCTTCCAGGG + Intergenic
1062214604 9:135382430-135382452 TCAGCCCCACCCGCCTTCCTCGG - Intergenic
1062237776 9:135520852-135520874 ACACACACACACACCTGTCTTGG + Intergenic
1062395618 9:136351460-136351482 CCAGCCTCCCACTCCTTCCTTGG - Intronic
1187745224 X:22402175-22402197 ACACACACACACACAATCCTTGG - Intergenic
1187963930 X:24592371-24592393 ACAGTCACACTCAGCATCCTTGG + Intronic
1188506273 X:30888730-30888752 TCATCCTCAAACACCTTCCTGGG + Intronic
1190732129 X:53233343-53233365 TCACCCACACACACCTCGCTGGG - Exonic
1194037314 X:88892157-88892179 ACACACACACACACATGCCTGGG + Intergenic
1194855995 X:98929929-98929951 ACAGACACACAAAACTACCTAGG + Intergenic
1195959281 X:110369034-110369056 ACAGCCACAAAGATCTTTCTAGG - Intronic
1196928374 X:120656541-120656563 TCAGCCCCAGACACCTTCCAGGG - Intergenic
1197630076 X:128848325-128848347 ACACACACACACACTTTTCTTGG - Intergenic
1197708930 X:129652806-129652828 ACAACCACTCAGACCCTCCTGGG - Intronic
1201644484 Y:16214170-16214192 ACAGCAACACACTCCAGCCTGGG + Intergenic
1201658331 Y:16371151-16371173 ACAGCAACACACTCCAGCCTGGG - Intergenic