ID: 902441114

View in Genome Browser
Species Human (GRCh38)
Location 1:16430670-16430692
Sequence CAGAAGCCAGCATTGTTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902441111_902441114 -4 Left 902441111 1:16430651-16430673 CCTGCAGCTCTTTCCGTTACAGA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 902441114 1:16430670-16430692 CAGAAGCCAGCATTGTTTTTGGG 0: 1
1: 1
2: 2
3: 19
4: 215
902441110_902441114 -3 Left 902441110 1:16430650-16430672 CCCTGCAGCTCTTTCCGTTACAG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 902441114 1:16430670-16430692 CAGAAGCCAGCATTGTTTTTGGG 0: 1
1: 1
2: 2
3: 19
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902441114 Original CRISPR CAGAAGCCAGCATTGTTTTT GGG Intronic
901260629 1:7868130-7868152 CAGAAGACAGCCTTTTTTTTTGG - Intergenic
902441114 1:16430670-16430692 CAGAAGCCAGCATTGTTTTTGGG + Intronic
902615627 1:17622053-17622075 CATAAGCCAGCACTGCTTTATGG + Intronic
902890089 1:19436884-19436906 CAGAGTCCAGCACTGTTTTCTGG - Intronic
905497726 1:38407138-38407160 CAAAATCCAGCATTGCTTTATGG + Intergenic
905688502 1:39925976-39925998 CAGAAGCCAGCATCTTGCTTGGG + Intergenic
909905971 1:81195446-81195468 AAGAAGCCATCACTGTTTTGAGG - Intergenic
911862448 1:102969936-102969958 GAGAAGACACCATTATTTTTTGG - Intronic
913682681 1:121201870-121201892 GAGGAGCTAGCATTGTTTTCAGG + Intronic
914034523 1:143989496-143989518 GAGGAGCTAGCATTGTTTTCAGG + Intergenic
914154929 1:145078472-145078494 GAGGAGCTAGCATTGTTTTCAGG - Intronic
914326267 1:146619853-146619875 CAGAAACCAGCAATAGTTTTGGG - Intergenic
914413091 1:147450554-147450576 CAGTAGCCACCATTATATTTGGG + Intergenic
915719916 1:157977406-157977428 CAGAGGCCAGCTTTGCTCTTAGG + Intergenic
916314415 1:163432955-163432977 AAGAAACCAACATTGTTTATTGG + Intergenic
917330882 1:173879217-173879239 CAGAATCCAGCAGTGTCTTAAGG + Intronic
917430544 1:174963163-174963185 CAAAAGCCAACACAGTTTTTGGG - Intronic
918150723 1:181796227-181796249 GAGAAGCCAGGATTCTTTTAGGG + Intronic
919145586 1:193630292-193630314 CAGGAGCCAGCTTTGGGTTTGGG + Intergenic
920469992 1:206220387-206220409 GAGGAGCTAGCATTGTTTTCAGG + Intronic
1062808518 10:443712-443734 CAGGAGCCAGGTTTCTTTTTTGG - Intronic
1063609729 10:7552446-7552468 CAATATCCAGGATTGTTTTTTGG - Intergenic
1064549164 10:16481251-16481273 CAGAAGCCTGCTTTGTTTGTTGG + Intronic
1064580568 10:16788830-16788852 CAGAAGCCAGCCTTGTAGCTAGG - Intronic
1065873296 10:29974686-29974708 CAGAACCCAGCCCAGTTTTTGGG - Intergenic
1067062883 10:43086990-43087012 CAGAAGGCTGCATGGCTTTTAGG + Intronic
1068613512 10:59086804-59086826 GAGAATCTAGCATTGTTTTAAGG + Intergenic
1069790355 10:71015659-71015681 AGGAAGCCAGCATAGGTTTTGGG + Intergenic
1069885656 10:71622046-71622068 CAGAAGTCAGCCTTGGTGTTGGG + Intronic
1071229141 10:83564785-83564807 AAGAAGCCAGCGCTGTTTGTTGG - Intergenic
1071540498 10:86478431-86478453 CAGAATCCATCCTTTTTTTTTGG - Intronic
1072484003 10:95837149-95837171 CAGAAGCAAGCCTGGTTCTTTGG + Intronic
1072770350 10:98132722-98132744 CAGAATCCAGTATTGTGGTTGGG - Intergenic
1072951755 10:99853013-99853035 CAGAAGCCAGCCTAAGTTTTGGG + Intergenic
1073946723 10:108759045-108759067 AAGAATACAGCAATGTTTTTAGG + Intergenic
1074142203 10:110683276-110683298 CAGAAGGCAGTTTTATTTTTTGG + Intronic
1074240500 10:111634245-111634267 CAGAAGCCATCAGTCTTTGTGGG - Intergenic
1076248553 10:128966617-128966639 AAGAACCCAGCTTTGTGTTTTGG - Intergenic
1077852409 11:6085715-6085737 CAGAAGCCAGGAATTATTTTAGG - Intergenic
1079282806 11:19103163-19103185 CAGTAGCCATCATTGTTTTCAGG - Intergenic
1079319841 11:19442631-19442653 CAGAAGCCTGCAGTGATGTTGGG + Intronic
1080116862 11:28631220-28631242 CAGAAGCCAGCATTTTAATTAGG + Intergenic
1081546237 11:44073878-44073900 GAGAAGCCAGAATTGCTGTTCGG + Intronic
1081906533 11:46673903-46673925 CAGAAGTCAGCCTTGTATGTGGG - Intronic
1082753135 11:57044410-57044432 CAGTACCCAGCATGGTTTTAAGG - Intergenic
1085193255 11:74647631-74647653 CAGTAGCCACCATAGTTGTTGGG - Intronic
1085535637 11:77215614-77215636 CCCAAGGCAGCATTGTTCTTGGG - Intergenic
1086195100 11:84128508-84128530 TAGAAGGAAGAATTGTTTTTGGG - Intronic
1087676580 11:101169434-101169456 CAGAAGCCAGAAGAGTTTTGGGG + Intergenic
1088867735 11:113864852-113864874 ATGAAGACAGTATTGTTTTTTGG + Intronic
1090750241 11:129740422-129740444 AAAAAGCCAGCATAGTGTTTTGG + Intergenic
1091580848 12:1788055-1788077 CAGAAGCCAGACTTGCTCTTCGG + Exonic
1091876780 12:3941333-3941355 CAGAATCCAGTATTGTTTTGAGG - Intergenic
1093290805 12:17319230-17319252 CAAAATCCAGCATTGCTTTATGG - Intergenic
1093582204 12:20795682-20795704 AAGGGGCCAGCATTATTTTTTGG + Intergenic
1097803293 12:63938585-63938607 CACAAGGCATCATTGTTATTTGG - Intronic
1100042567 12:90338496-90338518 TTGAGGCTAGCATTGTTTTTAGG - Intergenic
1101980128 12:109398811-109398833 CAGGGGCCAGCACTCTTTTTCGG + Intronic
1103726494 12:122999822-122999844 CAGAACCCAGCACTGATTCTGGG - Intronic
1106130536 13:26935889-26935911 CAGAAGACAGAATTATTTTTGGG + Intergenic
1106544337 13:30717211-30717233 CAGAAGCCAGACCTCTTTTTGGG + Intronic
1107230332 13:38101970-38101992 CATAAGCCTTCATTGTTCTTAGG + Intergenic
1107877307 13:44802161-44802183 CAGAACCCAGCATTGCATTCTGG - Intergenic
1108714707 13:53067788-53067810 CAAAAACCAGCCTTGTTTATAGG + Intergenic
1108843613 13:54651789-54651811 CAGAAGCCAGCTGTCTTTGTAGG + Intergenic
1110131829 13:72019972-72019994 CAGATTGCAGCATTGTTTATGGG + Intergenic
1111837760 13:93410023-93410045 CAGAAGCCAGCTTTGGATGTAGG - Intronic
1113351285 13:109531600-109531622 CACAAGACAACATTGTATTTTGG + Intergenic
1113709964 13:112456740-112456762 CAGAACCCTGCATTGATTTGGGG - Intergenic
1114024729 14:18514634-18514656 CAGAAACCAGCATTAATTTCTGG - Intergenic
1114026893 14:18535948-18535970 CAGAATCCACCAGTGTGTTTTGG - Intergenic
1115878993 14:37893538-37893560 CAGGTGCCAGCATTGCTTTATGG + Intronic
1116296963 14:43123629-43123651 CAGCAACCACCATTCTTTTTTGG - Intergenic
1116950762 14:50876563-50876585 CAGAGGCCAGCTTTGTTCCTGGG + Intronic
1117623431 14:57611246-57611268 CAGAAGCCAGATCTGTTTTGAGG + Intronic
1117996642 14:61484042-61484064 CAGAACCTATCATTATTTTTGGG - Intronic
1120551285 14:85876290-85876312 CAGAATCATGCATTGTTTTGAGG - Intergenic
1120891872 14:89498695-89498717 CAGAACGCAGAATTGTTTCTAGG + Intronic
1124103093 15:26713473-26713495 CTGAACCCAGCATTGTGTTTCGG - Intronic
1124375952 15:29128797-29128819 CTGAAGCCAGCACTGGTGTTTGG + Exonic
1127575846 15:60291211-60291233 CAGCAGGCAGCATTGTGTATTGG - Intergenic
1129868798 15:78928105-78928127 CTCTTGCCAGCATTGTTTTTTGG - Intronic
1130518827 15:84646603-84646625 AAAAAGCCAGAATTGCTTTTTGG - Intronic
1132222363 15:100114462-100114484 CAGAAGCCAGCATTTTTAAAAGG - Intronic
1134285067 16:12854165-12854187 CAGACGTCAGCATTTTTTTCGGG + Intergenic
1134294520 16:12933811-12933833 CAGAACCCTGGCTTGTTTTTTGG - Intronic
1134326278 16:13210859-13210881 CAGAAGACAGCATAGTTTCATGG - Intronic
1137917563 16:52449366-52449388 CAGAGGCCAGCATTTTGGTTGGG - Intronic
1138628816 16:58276977-58276999 CAGAAGCATACACTGTTTTTAGG - Intronic
1139029079 16:62857201-62857223 CAGAAGCCAGAATGGTATCTTGG + Intergenic
1139076724 16:63459909-63459931 CACATGCCAGCCTTTTTTTTAGG + Intergenic
1139184723 16:64792253-64792275 CACAAACCAACATTGTTTCTGGG + Intergenic
1140007300 16:71091093-71091115 CAGAAACCAGCAATAGTTTTGGG + Intronic
1144171463 17:12663591-12663613 CTGAAGCCAGCATTGATTGTAGG - Intergenic
1144619223 17:16805822-16805844 CAGAAGCCAGTATTGGGCTTTGG - Intergenic
1144893474 17:18509873-18509895 CAGAAGCCAGTATTGGGCTTTGG + Intergenic
1145138750 17:20434401-20434423 CAGAAGCCAGTATTGGGCTTTGG - Intergenic
1147055959 17:37835322-37835344 CAGAAGCCAGTATTGGGCTTTGG + Intergenic
1147969014 17:44209772-44209794 CAGAAGGCAGCAGTATTTTGGGG - Intronic
1148716867 17:49722223-49722245 CTGGAGCCACCATTGTTCTTTGG - Intronic
1150389574 17:64782387-64782409 CAGAACTCAGCATTGGTCTTTGG + Intergenic
1151853642 17:76706772-76706794 AAGAAGCCAACATTCTTCTTTGG - Intronic
1154945482 18:21157846-21157868 CAGAACCCAGCAGTGCTGTTGGG - Intergenic
1156600684 18:38602342-38602364 CTGAAGCCAGAATTGTTACTGGG - Intergenic
1156777097 18:40804769-40804791 CTGAAGCCAGCACACTTTTTTGG - Intergenic
1157050526 18:44158436-44158458 AAGAAGCCAACAATTTTTTTAGG - Intergenic
1157550193 18:48576038-48576060 CACAAGCCTGCATTGTTCTTCGG - Intronic
1165078782 19:33295910-33295932 CAAAAGCCAGCATGATTTCTGGG - Intergenic
1166325222 19:42045738-42045760 CAGCAGCCAGCATTTCTTGTGGG + Intronic
926307228 2:11647086-11647108 AAAAAGCAAACATTGTTTTTGGG - Intergenic
926505591 2:13711092-13711114 CAGAAGGCAGAATTGTTTTTTGG - Intergenic
927051194 2:19330996-19331018 CAGAAGACAGCCTTGATTCTTGG + Intergenic
927541619 2:23916983-23917005 AAGAATCTAGCATTGTGTTTGGG - Intronic
928175556 2:29031715-29031737 CAGAAGATAGCATTGCTTGTCGG - Intronic
928787374 2:34905171-34905193 AAGAAGCCAACACTGTTGTTAGG - Intergenic
929230130 2:39550548-39550570 CAGAAACAAGCATTGATTTTAGG - Intergenic
929538224 2:42798539-42798561 AAGAAGCCAGCAGTGTATCTGGG - Intergenic
931104543 2:59040940-59040962 CAAAAGCCTGCATTATTTTCTGG + Intergenic
935507713 2:103927088-103927110 CATAAGACAACATTGTTTTCAGG + Intergenic
936777277 2:115988925-115988947 CAGCAGCCCACAATGTTTTTGGG - Intergenic
936882022 2:117265145-117265167 CAGCAGCCAGCATGATTCTTTGG - Intergenic
936942975 2:117904544-117904566 CAGAATCCAGAATTACTTTTTGG + Intergenic
938128761 2:128693263-128693285 GAGAAGCCAGCAGTGTCCTTAGG - Intergenic
940739613 2:157492500-157492522 CACAAGCCTGCACTGTATTTCGG - Intergenic
942165122 2:173234012-173234034 CCTAAGCCAGCATAGCTTTTAGG - Intronic
942203670 2:173597534-173597556 CAGGTGCCAGTATTGTTCTTAGG + Intergenic
942726823 2:179018597-179018619 GAGAAGGCAGCATTGTAATTGGG - Intronic
943496650 2:188629210-188629232 CAGAGGCATGCAATGTTTTTTGG + Intergenic
944285865 2:197949197-197949219 CAGAAGTCAGAATTTGTTTTTGG + Intronic
944539241 2:200740775-200740797 GAGAAGCCGGCATTGCTATTCGG + Intergenic
944771585 2:202919723-202919745 CAGAAGAGAGCTTTGTTTATTGG + Intronic
1170295428 20:14819643-14819665 CAGAAGACCTCATTGATTTTAGG + Intronic
1171384892 20:24763508-24763530 CTGAAGGGAGCAGTGTTTTTGGG - Intergenic
1172206794 20:33168077-33168099 CAGAAGCAAGCCTTGGTTCTGGG - Intronic
1172276820 20:33684676-33684698 TAGCAGCCACCATTGTTTTGAGG - Intronic
1179097868 21:38331590-38331612 CAGAGGACAGAATGGTTTTTGGG - Intergenic
1180448890 22:15442115-15442137 CAGAAACCAGCATTAATTTCTGG - Intergenic
1180451029 22:15463143-15463165 CAGAATCCACCAGTGTGTTTTGG - Intergenic
1182081873 22:27535094-27535116 CATCAGCCAGAATTCTTTTTGGG - Intergenic
1183946560 22:41329558-41329580 CAGAAGTAAGCATTCTTTATAGG + Intronic
950716269 3:14849851-14849873 CAGAAGCCAGCATTTTTTTTAGG - Intronic
952756150 3:36869543-36869565 CAGATGGAAGCATTGTCTTTAGG - Intronic
952923097 3:38300661-38300683 AAGAGCCCAGCATTGTTATTGGG + Intronic
955326608 3:58013487-58013509 CAGATGCCAGCATGTCTTTTGGG + Intronic
956679311 3:71763185-71763207 GAGAAGCCTACATTGTTTTTTGG + Intergenic
957182435 3:76897278-76897300 TTAAAGCCAGCATTTTTTTTTGG - Intronic
959237096 3:103738361-103738383 CAAAAGACAGCAGTATTTTTGGG - Intergenic
959925174 3:111913091-111913113 TAGAAGCCAGAATTGAGTTTGGG + Intronic
961912241 3:130330034-130330056 CTGCAGCCAGCATTGTTCTGGGG + Intergenic
961999732 3:131283382-131283404 TAGAAGCCAGCTTTGGTCTTGGG - Intronic
962409469 3:135128581-135128603 CAGAACCCAGCATTGTTAGGAGG + Intronic
963608560 3:147436339-147436361 CAGAAGAAGGCATTGTTATTAGG - Intronic
964880034 3:161412989-161413011 CAGAAGTTAGCATAGCTTTTAGG - Intergenic
965183289 3:165432461-165432483 CAAAATCCAGCATTGCTTTATGG - Intergenic
965242564 3:166221542-166221564 AAGAAGACAGCATTTTTTTTAGG + Intergenic
965668839 3:171125458-171125480 CAGAAGATAGTATTGTTCTTAGG - Intronic
966521805 3:180881703-180881725 ATGAGGCCAGCATTGATTTTAGG - Intronic
969995120 4:11304083-11304105 CAGAAGCCATAGTTGTTTATAGG - Intergenic
970604305 4:17665120-17665142 CATGAGCCAGCATTGTTCTCAGG - Intronic
970620469 4:17811889-17811911 TAAAAGCCAGTATTGATTTTGGG + Intronic
971312654 4:25538775-25538797 CAGAAGCCAGCAGTGTGCATGGG - Intergenic
971384561 4:26131466-26131488 CAGATGCCAGTATTGCTTCTGGG + Intergenic
971973354 4:33650374-33650396 CAGAAGCCATCTTTGTATCTAGG - Intergenic
972872607 4:43318668-43318690 CAGCAGCCATCCTTGTTTTCAGG + Intergenic
973921016 4:55685068-55685090 CAGAAGCCAGCACTGGATTCAGG - Intergenic
974098579 4:57392400-57392422 CACAATCCTGCTTTGTTTTTTGG - Intergenic
974137628 4:57838390-57838412 TAGAAACCAGCATTGGTTTGAGG - Intergenic
975168747 4:71208599-71208621 TAGAAGCAAGCCTTTTTTTTTGG + Intronic
978094277 4:104756564-104756586 CAAAAGCCAGTTTTGGTTTTAGG - Intergenic
978819485 4:112949099-112949121 CAGCAGGCAGCAGTGTTCTTGGG + Intronic
978911937 4:114074174-114074196 CACAAGCCAGCTTTATTTCTGGG + Intergenic
985052725 4:186009083-186009105 CAGAGGCCAGCAATGGTTTTTGG - Intergenic
986264685 5:6181597-6181619 CTGCACCCAGCATTGTCTTTGGG + Intergenic
987167852 5:15219768-15219790 CTGAGGCCAGCATTCTTTGTTGG + Intergenic
990724434 5:58737483-58737505 AAGAAGCCTGCATTCTTGTTAGG - Intronic
992212635 5:74495808-74495830 CAGAAGCAAGAATAGTTTTCAGG + Intergenic
992665997 5:79010030-79010052 CAGAAGCCAAGACTATTTTTAGG - Intronic
994010070 5:94891871-94891893 CAGAAGCCATCCGGGTTTTTAGG - Intronic
994090049 5:95801962-95801984 CTGAACACACCATTGTTTTTGGG + Intronic
995840497 5:116439168-116439190 CTGATGCCAGCAGTGTTATTAGG - Intergenic
996139957 5:119894938-119894960 CAGAAGACAAAATTGTTTTCTGG - Intergenic
996322518 5:122234993-122235015 CAGGAACCAGAATTGCTTTTGGG + Intergenic
996428701 5:123345091-123345113 CAGAAGCAAGCCTTATGTTTTGG - Exonic
996490087 5:124084518-124084540 CAGAAGAAAGAATTGTTTTGTGG - Intergenic
1000099389 5:158000706-158000728 AAGAGGCCAGCATTTTTTCTTGG + Intergenic
1005391900 6:25342442-25342464 TAGGAGGCAGCATTGATTTTGGG + Intronic
1008706080 6:54160766-54160788 CAGAACCCAACAATGTCTTTGGG - Exonic
1011492791 6:87909991-87910013 CAGAAGGAAGCAGTGTTTTGGGG + Intergenic
1011954415 6:93008095-93008117 GAGAAGCAAGCATTGTGTTATGG + Intergenic
1012218256 6:96615463-96615485 CAGGAAGCAGCATTCTTTTTTGG + Intronic
1013239470 6:108230139-108230161 CAGAATTCAGCATTCTTTCTGGG - Intronic
1014599801 6:123396941-123396963 CAGCAGCCAGAATTGGTCTTTGG + Intronic
1015823253 6:137284865-137284887 AAGAAGCCAGCAGTGATCTTTGG + Intergenic
1016041575 6:139437110-139437132 CAGCAGCCAGCATTTTGCTTAGG + Intergenic
1018256937 6:161930046-161930068 CTGAAGCCAGCATTCTCTCTTGG + Intronic
1018934461 6:168264695-168264717 CAGAAGCCAGCGGTGTACTTTGG - Intergenic
1021959450 7:25857802-25857824 CAGAAACCAGGATTGTTTGGGGG - Intergenic
1023131665 7:37009574-37009596 TAGAATCCAGCATAGTTTGTTGG + Intronic
1029950928 7:104584837-104584859 CAGAAGTCAGCATGGTAATTCGG + Intronic
1034087586 7:148334328-148334350 CTGAAGGCAGCATGGGTTTTAGG + Intronic
1035556317 8:569658-569680 CAGAAGCCTACATTATTTTAAGG + Intergenic
1035824536 8:2630233-2630255 CACATGCCAGCATTCTTTTGGGG - Intergenic
1036843892 8:12148670-12148692 CAGAAGGAAGCAGTCTTTTTTGG + Intergenic
1037205312 8:16310750-16310772 CACAATCCAGCTTTGTTTTAAGG + Intronic
1037743605 8:21626473-21626495 CAGAAGCCAGTAATGATTTCTGG + Intergenic
1038013173 8:23490960-23490982 CAGAAGCCATGATTGTTCTTAGG + Intergenic
1038252319 8:25916780-25916802 CAGAAGCCAGCATATTGTGTGGG - Intronic
1038589380 8:28822520-28822542 CTAAGGCCAGCACTGTTTTTGGG - Intronic
1038861602 8:31394085-31394107 CAGGAGACAGCATTGTTATTTGG + Intergenic
1040062851 8:43119146-43119168 CAAAAGCCAGCATCGTTTTTAGG + Intronic
1041781509 8:61582146-61582168 CAGAAGCAAGAATTGTATATGGG + Intronic
1041846662 8:62336825-62336847 CCGAAGTCAGCAAAGTTTTTTGG + Intronic
1044881657 8:96729272-96729294 GAGAAGACAGCATTGTCTTAGGG - Intronic
1045568774 8:103348754-103348776 CAGAACCCAGCTCTGTTTTTAGG - Intergenic
1046314605 8:112482847-112482869 CAGAAACCACCATTACTTTTAGG + Intronic
1048280080 8:133099122-133099144 GAGAAGCCAGCATTGAAGTTGGG + Intronic
1048412837 8:134193462-134193484 CAGAAACCAGCATGGTTCTCAGG + Intergenic
1050406299 9:5312040-5312062 CAGAACACTTCATTGTTTTTGGG + Intergenic
1050582625 9:7076572-7076594 GAGCAGCCAGCATCGTGTTTAGG + Exonic
1054714538 9:68544071-68544093 CAGAGATCAGCATCGTTTTTAGG + Intergenic
1054720190 9:68596121-68596143 CAGAGGCCAGCATAGTATTGAGG - Intergenic
1056723244 9:89089497-89089519 CAGAAGCCAGCACTGCCCTTAGG + Intronic
1056976566 9:91261712-91261734 CAGAAAGCAGCAGTGATTTTAGG + Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057890079 9:98863349-98863371 CAGAAGACAGTCTTGATTTTTGG - Intergenic
1058657711 9:107239224-107239246 GAGAAGCCAGCAGTGTTTTGGGG + Intergenic
1058788603 9:108417915-108417937 CAGATGACAGCATTGTTGCTGGG + Intergenic
1059392778 9:114009335-114009357 CTGAAGCCATCATCGATTTTCGG - Intronic
1059472201 9:114514226-114514248 CAGAAGCCAGTATGCTTCTTGGG - Intergenic
1059991653 9:119870923-119870945 CAGAAGGGAGCATTGTTAGTAGG - Intergenic
1188232083 X:27676916-27676938 AAGAAGACAGCATTTTGTTTAGG - Intronic
1190842566 X:54159214-54159236 GAGAACTCAGCATGGTTTTTGGG - Intronic
1194128329 X:90047728-90047750 CAGATGGCAGCATGGTTTTTAGG + Intergenic
1195032613 X:100941149-100941171 AAAAAGCCATCATTGTTATTAGG - Intergenic
1195904911 X:109834842-109834864 CAGAAGTCAGCATATATTTTTGG + Intergenic
1198484517 X:137073529-137073551 CACAAGGAAGAATTGTTTTTTGG - Intergenic
1198591206 X:138184690-138184712 CAGAAGCCAGAATTTTTTATGGG + Intergenic
1202090824 Y:21186983-21187005 CAGAAGACAGTAATGTTTCTTGG - Intergenic