ID: 902443584

View in Genome Browser
Species Human (GRCh38)
Location 1:16447399-16447421
Sequence CAGTGAGCCCCGAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902443584_902443593 21 Left 902443584 1:16447399-16447421 CCTTCTTTCCTCGGGGCTCACTG 0: 1
1: 1
2: 0
3: 13
4: 200
Right 902443593 1:16447443-16447465 CAGGTACTAGCCTCTTCAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 167
902443584_902443589 2 Left 902443584 1:16447399-16447421 CCTTCTTTCCTCGGGGCTCACTG 0: 1
1: 1
2: 0
3: 13
4: 200
Right 902443589 1:16447424-16447446 CCCTCTTATAGTCCTGCCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902443584 Original CRISPR CAGTGAGCCCCGAGGAAAGA AGG (reversed) Intronic
900552964 1:3265659-3265681 CAGGCAGCCCCGGGGCAAGAGGG - Intronic
900704843 1:4073962-4073984 CTGTGAGCCCTGAGGGAAGGGGG + Intergenic
900880344 1:5377049-5377071 CAGTGAGACCCGAGGGCAGCTGG - Intergenic
900945141 1:5826815-5826837 CTGCGAGGCCCGAGGAAAGCGGG + Intergenic
902443584 1:16447399-16447421 CAGTGAGCCCCGAGGAAAGAAGG - Intronic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
905649790 1:39648504-39648526 CATTGGGCCCAGAGTAAAGATGG + Intergenic
905706754 1:40066127-40066149 ATGTGAGCCCATAGGAAAGAAGG + Intronic
906146540 1:43563964-43563986 CAGGGAAACCCGAGGAAGGAGGG + Intronic
907373493 1:54017842-54017864 GAGTGAGCCCCGGGGCAGGACGG + Intronic
908782276 1:67701234-67701256 GTGAGAGCCCAGAGGAAAGAGGG - Intergenic
912531660 1:110328438-110328460 CAGTCAGCCAACAGGAAAGAAGG - Intergenic
913439614 1:118883992-118884014 CAGTGGTGCCCGTGGAAAGAGGG - Exonic
915634099 1:157174360-157174382 CCATGAGCCCCGAGGGAGGAGGG + Intergenic
916139045 1:161677420-161677442 CAGAGAGGGCCTAGGAAAGAAGG - Intronic
917175053 1:172224862-172224884 TAGAGAGCCCCAAGGCAAGAGGG - Intronic
920747555 1:208643406-208643428 CAGTCAGCTCTGAGGAGAGATGG + Intergenic
1066449113 10:35511984-35512006 GAGTGAGCCTCGAGGCAAGGTGG + Intronic
1067037520 10:42931300-42931322 CAGTGAGCCCCCAGTATTGAGGG - Intergenic
1067557928 10:47285362-47285384 AAGGGAGGCCAGAGGAAAGAAGG + Intergenic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1071758043 10:88568081-88568103 CAGTGAGCCATGATGAAAGCAGG + Intronic
1073248408 10:102107371-102107393 CAGTCACCCCAGAGGAAAGGGGG + Intergenic
1073847717 10:107577801-107577823 CAATTAGCCTCTAGGAAAGAGGG + Intergenic
1075209305 10:120477691-120477713 CAGTGAGCCCCTTGGGAGGAGGG + Intronic
1076193694 10:128500073-128500095 CAGTGAGGCCCCAGCAAAAAAGG - Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076830528 10:132992199-132992221 CTGTGAGCCTCGAGGACAGAGGG + Intergenic
1076830532 10:132992217-132992239 GAGGGAGCCTCGAGGACAGAGGG + Intergenic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077221091 11:1416793-1416815 CAGTGAGCCCCGTGGATCCACGG + Intronic
1077225391 11:1437174-1437196 CTGTGAGCCCCGACTAAAGGAGG + Intronic
1077309472 11:1882014-1882036 CAGCCAGCCCCGAGGGAGGAAGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078453700 11:11458853-11458875 CACTGAGACCCGTGGAAAGCTGG + Intronic
1082795351 11:57374895-57374917 CAGAGAGCCCTGGGGAAAGTGGG - Intergenic
1083595483 11:63916778-63916800 CAGGGCGCCCCGAGGACAGGGGG - Exonic
1083994521 11:66265565-66265587 CAGTGGGCCCTGAGGAAGCATGG - Intronic
1084417717 11:69043057-69043079 AACTGAGCCCAGAGGCAAGAAGG - Intergenic
1084935748 11:72585684-72585706 CAGTGAGCCCTAGGGAAGGAAGG - Intronic
1085739272 11:79065081-79065103 CAGTGAGCCCTGGGGTAAGAAGG - Intronic
1086210221 11:84309250-84309272 CAGTGATTCCCAAGGACAGACGG - Intronic
1087781569 11:102306364-102306386 CAGTGTGCCCTGGGGAAAGGGGG + Intergenic
1089315983 11:117591817-117591839 CAGAGAGTCCCAAGCAAAGAAGG - Intronic
1089732818 11:120529994-120530016 CACTGAGCCACCAGGAAGGAAGG - Intronic
1095494242 12:42768150-42768172 GAGTGAGCCCCCATGACAGATGG - Intergenic
1097689810 12:62724185-62724207 CAGAAAGCCCCAAGGAAACAGGG - Intronic
1098290271 12:68951517-68951539 CACTGAGCCCCAGGGACAGATGG + Intronic
1098764804 12:74472457-74472479 CTGAGAGCCCAGAGGAAACAAGG + Intergenic
1100287523 12:93181671-93181693 CAGTGAGCTCCTAGGACAAAAGG - Intergenic
1101992415 12:109497910-109497932 CAGTGACCCCTGAGGTAAGCAGG + Exonic
1102108957 12:110349530-110349552 CAGTGAGCTCCCAGGCAAGCAGG + Intronic
1103163952 12:118754146-118754168 CAGTGAGCACCAAGGATATATGG + Intergenic
1105289392 13:19039560-19039582 CAGTAAGCCCTGAGGAAGCAGGG - Intergenic
1106462040 13:29979541-29979563 CAGTGAGCCAAGAGCCAAGATGG - Intergenic
1107131852 13:36905020-36905042 CACTGAGCACTGAGGGAAGACGG + Intronic
1107517175 13:41141437-41141459 CAGTTAGCCCACAGGAGAGATGG - Intergenic
1112367211 13:98765408-98765430 TAGTGAGCCACGAGGAACGCCGG + Intergenic
1113066999 13:106382772-106382794 AAGTGAGCCCAGGGGTAAGACGG + Intergenic
1119443346 14:74644342-74644364 CTGTGAGCCTCGAGTAAAGCTGG + Intergenic
1119716147 14:76860869-76860891 CAGGGAGCCCTGGGGAAAGCTGG + Intronic
1120266757 14:82260578-82260600 AAGTGGGCTCTGAGGAAAGAGGG - Intergenic
1122127922 14:99589160-99589182 GAGTGAGCCCTGAGGACAGCAGG + Intronic
1122127934 14:99589218-99589240 GAGTGAGCCCTGAGGACAGCAGG + Intronic
1126989264 15:54353725-54353747 CAGTGAGGTCAGAGGAAAGCTGG - Intronic
1127727399 15:61763486-61763508 ATGTGAGCCCCAAGGAAACAGGG - Intergenic
1128699453 15:69793751-69793773 CAGTGAGTTCCGAGCAAAGGGGG - Intergenic
1129832783 15:78681615-78681637 CAGTGAGGCCACAGGAGAGAGGG + Intronic
1130322799 15:82854605-82854627 CAGTGAGCCCCGAGGCCAGCTGG - Intronic
1131147188 15:90021644-90021666 CAGTGAGCCCCCAGTCCAGAAGG + Intronic
1132012421 15:98287770-98287792 CAGAGGGCCCCGTGGAAAGGAGG - Intergenic
1134310395 16:13070881-13070903 TGAGGAGCCCCGAGGAAAGAGGG + Intronic
1135122165 16:19775661-19775683 CAGTGACCTCAGAGGTAAGAGGG - Intronic
1136866775 16:33765633-33765655 CACTGTACCCCAAGGAAAGAAGG + Intergenic
1138206267 16:55127397-55127419 AAGTGATCCAGGAGGAAAGACGG + Intergenic
1138726727 16:59148409-59148431 CAGTGAGCCACGAGACAAGGGGG + Intergenic
1140179985 16:72705983-72706005 CAGTAAGCTCCAAGGACAGAGGG - Intergenic
1142314174 16:89333035-89333057 CAGGGAACCCCCAGGGAAGAAGG + Intronic
1203105387 16_KI270728v1_random:1350569-1350591 CACTGTACCCCAAGGAAAGAAGG - Intergenic
1203128127 16_KI270728v1_random:1611799-1611821 CACTGTACCCCAAGGAAAGAAGG + Intergenic
1142678970 17:1534425-1534447 GAGGGAGCCCCCAAGAAAGAAGG + Intronic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1146721875 17:35129657-35129679 AAGTGAGCCCTGGGAAAAGAGGG + Exonic
1147764329 17:42823723-42823745 CAGCGAGACCCTTGGAAAGAGGG - Intronic
1151982120 17:77519272-77519294 CACAGAGCAGCGAGGAAAGAAGG - Intergenic
1152341340 17:79727320-79727342 CACTGTACCCCAAGGAAAGAAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157828878 18:50838344-50838366 CATTGAGCCCAAAGGAAAGTAGG - Intergenic
1158962418 18:62597504-62597526 CAACAAGCCCCGAGGAAAGGTGG + Intergenic
1161285179 19:3464803-3464825 GAGCGGGCCCCGAGGACAGACGG - Intronic
1161391631 19:4024164-4024186 CAGTGAGCCCAGGAGAAAGTGGG - Intronic
1161457870 19:4378782-4378804 AACTGAGTCCCGAGGAATGATGG + Intronic
1162065113 19:8120831-8120853 CTGTGAGCTCCAAGGAAAGAGGG + Intronic
1164594754 19:29525840-29525862 GAGCGACCCCCGAGGAGAGAGGG + Intergenic
1168400148 19:56080920-56080942 AGCTGAGCCGCGAGGAAAGAGGG - Intergenic
925161053 2:1684702-1684724 CAACGACACCCGAGGAAAGATGG - Intronic
925636426 2:5945651-5945673 CAGTGAGTCCTGAGGAAAACAGG - Intergenic
925663883 2:6232306-6232328 CAGAGAGCACAGAGGAAAGGAGG - Intergenic
925910086 2:8568121-8568143 CAGTGAGCCCAGAGGCCAGGAGG - Intergenic
926087507 2:10029346-10029368 CAGTGAGCCCCCGTGAAACAAGG + Intergenic
926421136 2:12700691-12700713 CAGTGACCCCACAAGAAAGATGG + Intergenic
926913707 2:17874230-17874252 CAGTGAGCATAGAGGAGAGATGG + Intergenic
927437057 2:23075774-23075796 CAGTGAGACATGAAGAAAGAGGG - Intergenic
927445533 2:23157794-23157816 CAGGGAGACACGAAGAAAGAGGG - Intergenic
927857245 2:26535406-26535428 CTGGGAGCCCCGTGGGAAGATGG - Intronic
931224115 2:60314676-60314698 CAGAGAGACCCGAGGCAACATGG - Intergenic
932672027 2:73746200-73746222 CAGTGAGCCAGGAGGACACACGG + Intergenic
932767112 2:74477697-74477719 CATAGAGCCCTGAGGAAGGAAGG - Intronic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
935948642 2:108308949-108308971 CAGCCAGCCCTGAGGAAACATGG + Exonic
937757590 2:125559291-125559313 CAATGAGTCCCAAGGAAATAGGG - Intergenic
939413804 2:141866084-141866106 TAGTGACCCCCCAGGGAAGAGGG + Intronic
943057361 2:182998770-182998792 CAGTGAGCCAAGAGCCAAGATGG + Intronic
943744923 2:191452265-191452287 CTGTGAGGCCTGAGGAAAGAAGG + Intergenic
943798181 2:192024971-192024993 CAGAGAGGCCCGAACAAAGAGGG + Intronic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948687249 2:239677071-239677093 CAGGGAGCACCAGGGAAAGACGG + Intergenic
1168889703 20:1286993-1287015 AAGTGGGTCCCAAGGAAAGATGG - Intronic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1173457734 20:43216843-43216865 CACTGTGCCCCGAAGCAAGAAGG + Intergenic
1175201486 20:57280893-57280915 CAGAGACCCCTGAGGACAGAGGG + Intergenic
1175621993 20:60455103-60455125 CAGTGAAACCAGAGGACAGATGG + Intergenic
1176383777 21:6127045-6127067 CAGTGGGCCCTGGGGAAACACGG + Intergenic
1177633184 21:23752714-23752736 CAGTGGGCCTCTAGGAATGATGG + Intergenic
1178112710 21:29385091-29385113 CATTGTGCCAGGAGGAAAGAAGG - Intronic
1179233690 21:39527063-39527085 GAGGGAGCCCTGAGGTAAGAGGG - Intergenic
1179739693 21:43411193-43411215 CAGTGGGCCCTGGGGAAACACGG - Intergenic
1183364868 22:37401564-37401586 CAGTGGGCCCTCAGGAAACACGG + Intronic
1183484226 22:38080819-38080841 CGGTGCGCCCCGAAGGAAGAGGG - Exonic
1183577610 22:38701621-38701643 CGGGGAGCCCCCAGGCAAGAAGG - Intergenic
952001432 3:28789796-28789818 CAGTGAGGAGCCAGGAAAGAAGG - Intergenic
955139062 3:56250870-56250892 CAGTGAGACCCAGTGAAAGATGG + Intronic
956857988 3:73294624-73294646 TAGGGTGCACCGAGGAAAGAAGG - Intergenic
956939861 3:74145733-74145755 CAGTGAGACCCGGGGAGAGAGGG + Intergenic
963028432 3:140942326-140942348 GAGTGAGGCCCGGGCAAAGAGGG + Intronic
964268530 3:154929529-154929551 CTGTGAGCCAGGAGGCAAGAGGG + Intergenic
967200536 3:187068897-187068919 CAGGGAGGCCTGAGGACAGAGGG - Intronic
968813248 4:2809361-2809383 CACTGAGCCCAGAGGAGGGAGGG - Intronic
969457712 4:7309689-7309711 CCCAGAGCCTCGAGGAAAGAAGG - Intronic
970564790 4:17321330-17321352 CAGTGAATCCCGGTGAAAGAAGG - Intergenic
972184637 4:36513767-36513789 CAGTGAGCCATGAGCCAAGATGG + Intergenic
977766065 4:100799104-100799126 CAGTTTGCCCTGATGAAAGAAGG - Intronic
977988057 4:103408653-103408675 CAGTAAGGCTCGAAGAAAGAGGG - Intergenic
978741620 4:112144457-112144479 CAGTGAGACACTAGGAAAGGAGG + Intergenic
980389706 4:132127175-132127197 CAGTGAGCTCCAAGGAGACAAGG + Intergenic
981255501 4:142656499-142656521 CAGTGAGTCCCGAAAAAGGAAGG - Intronic
985866295 5:2517087-2517109 CACTGAGGCCCCAGGAAAGCGGG + Intergenic
985936877 5:3103997-3104019 AATTGAGCCCAGAAGAAAGATGG - Intergenic
992314431 5:75537434-75537456 CAGAGAGCACGGAGGAATGAAGG - Intronic
993478033 5:88388937-88388959 CAGTGAGCTCCCAGGAATAATGG + Intergenic
995569364 5:113463174-113463196 CAGAGAGCCTAGAGGAGAGAGGG + Intronic
998167821 5:139854554-139854576 CAGTGAGCCCAGAGGAGACTGGG - Intronic
1001410714 5:171509411-171509433 CCATGAGCCCCGGAGAAAGAGGG + Intergenic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1002867151 6:1131529-1131551 CACTGAGCCCTGGGGACAGAGGG - Intergenic
1003121208 6:3320209-3320231 CACTGAGCTCCAGGGAAAGAAGG - Intronic
1003265191 6:4559618-4559640 CAGGGAGCCCCAGGGAAAGCAGG - Intergenic
1004996578 6:21199280-21199302 CAGTGCGTCCCCAGGAAACAGGG + Intronic
1005015565 6:21372006-21372028 CTGTGAGCTACGAGGAATGAAGG - Intergenic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1007498305 6:42277016-42277038 CAGCCAGCCCAGAGGAAAGATGG - Intronic
1009393818 6:63173540-63173562 CAAAGAGCCCAGAGGAAAGAGGG - Intergenic
1009816755 6:68747055-68747077 CAGTGAGCCCCTTGGAAACTAGG + Intronic
1012307545 6:97677182-97677204 AAGGAAGCCCAGAGGAAAGAGGG - Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1015371326 6:132456898-132456920 CAGTGGCCTCTGAGGAAAGATGG - Exonic
1016610955 6:145989026-145989048 CAGTGAGCCCTAAAGAACGACGG - Intergenic
1018141771 6:160844909-160844931 CAGTTAGCCCAGAGAAAAGATGG - Intergenic
1018142450 6:160852731-160852753 CGGTGAACCCAGAGAAAAGATGG - Intergenic
1018142576 6:160853931-160853953 CAGTGAACCCAGAGAAAAGATGG - Intergenic
1018720011 6:166565362-166565384 CAGTCAGTCCCGAGGGAAGCTGG - Intronic
1019913418 7:4115605-4115627 CTGGGAGCCCCAAGGAAAGGAGG - Intronic
1022517337 7:30984305-30984327 CAGAGAGCCCCCAGGAATGTTGG + Intronic
1023747965 7:43340019-43340041 TAGTGAGCCACCAGGAAAAAGGG + Intronic
1024746197 7:52409115-52409137 CTGTGAGCCCCCAGGTAAGGAGG - Intergenic
1026087611 7:67275435-67275457 CAGTGAACCCTCAGGAAAAAAGG - Intergenic
1026726621 7:72874796-72874818 CAGTGAACCCTCAGGAAAAAAGG + Intergenic
1027034692 7:74916559-74916581 CAGTGAATCCTCAGGAAAGAAGG + Intergenic
1027117219 7:75490814-75490836 CAGTGAACCCTCAGGAAAAAAGG - Intergenic
1027274590 7:76544788-76544810 CAGTGAACCCTCAGGAAAAAAGG + Intergenic
1029720284 7:102359245-102359267 CAGTGAACCCTCAGGAAAAAAGG + Intergenic
1030252086 7:107457891-107457913 CAGTGAACCCCAAGCAAGGAAGG + Intronic
1031960578 7:127985807-127985829 CAGTGTACCCCGTGGACAGAAGG + Intronic
1032443465 7:131960275-131960297 GAGTGAGCCCCATGGAAAAAAGG - Intergenic
1034309140 7:150071647-150071669 CTGTGGGCCTCGAGGACAGAGGG + Intergenic
1034797715 7:154028989-154029011 CTGTGGGCCTCGAGGACAGAGGG - Intronic
1035333369 7:158110891-158110913 CCCTGCGCCCCGAGGAAGGAAGG - Exonic
1037913209 8:22756673-22756695 CAATGAGCCCCCAGGCAAGTGGG - Intronic
1038459276 8:27702720-27702742 CAGTGAGCCCGGGGGAGGGAGGG + Intergenic
1040484566 8:47857728-47857750 AAGTGAGCCCCGAGGAAAGAAGG + Intronic
1042497607 8:69472254-69472276 TGGTGAGCCAGGAGGAAAGAAGG - Intronic
1043449002 8:80348236-80348258 CAGTATGCCCCAAGGAAAGATGG - Intergenic
1045459654 8:102414467-102414489 CTGGGAGCCCTGAGGAAGGAAGG + Intergenic
1046784802 8:118254552-118254574 GAGTGAGGCCCCAGGACAGAAGG - Intronic
1048977637 8:139681886-139681908 CAGGGAGACACCAGGAAAGATGG + Intronic
1049688108 8:143947091-143947113 CAGTGATCCCTGTGGAAAGCTGG + Intronic
1052173012 9:25425516-25425538 CAGAGGCCCCAGAGGAAAGAAGG + Intergenic
1052269303 9:26610069-26610091 AAGGGAGCCCAGAGGAAAGAAGG + Intergenic
1052444458 9:28542378-28542400 CAGAGAGGCCTAAGGAAAGATGG + Intronic
1052672909 9:31581068-31581090 CTCTGAGCCCCAAGGAAATAGGG + Intergenic
1054140709 9:61527310-61527332 CAGTTAGACAAGAGGAAAGAAGG - Intergenic
1056433971 9:86557307-86557329 CAGTGCACCCCTGGGAAAGAAGG + Intergenic
1056665296 9:88576785-88576807 CAGAGAACCCAGAGGAAAGCAGG - Intronic
1059746368 9:117205618-117205640 CACTGAGCATCAAGGAAAGATGG + Intronic
1061485391 9:130917992-130918014 CTGTGAGCCCCGAGCACACACGG - Intronic
1061912958 9:133734667-133734689 AAGTGAGACCTGAGGAAAGTGGG + Intronic
1062009374 9:134258956-134258978 CAGGGAGCCCCGAGGCATGGGGG - Intergenic
1062057390 9:134475637-134475659 CAGTGAGCCCCCAGCCAGGATGG + Intergenic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1189332793 X:40153611-40153633 CAGCGAGCCCAGGGGAAAGGGGG - Intronic
1198599826 X:138270343-138270365 CAGTGAGAACGGAGGAAAGTAGG - Intergenic
1199787471 X:151117833-151117855 CTGTGAGCCCACAGGCAAGAAGG - Intergenic
1200179251 X:154140492-154140514 AAGAAAGCCCCAAGGAAAGAGGG - Intergenic
1200207592 X:154328591-154328613 AAGTGTGCCCCGACGAAAGCAGG + Intronic