ID: 902449983

View in Genome Browser
Species Human (GRCh38)
Location 1:16490866-16490888
Sequence TCTGCGGCTCCTCCTCCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 1, 2: 4, 3: 39, 4: 377}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902449971_902449983 5 Left 902449971 1:16490838-16490860 CCCTGGCCCTCCCTGTTGTGCCC No data
Right 902449983 1:16490866-16490888 TCTGCGGCTCCTCCTCCAGCCGG 0: 1
1: 1
2: 4
3: 39
4: 377
902449972_902449983 4 Left 902449972 1:16490839-16490861 CCTGGCCCTCCCTGTTGTGCCCC No data
Right 902449983 1:16490866-16490888 TCTGCGGCTCCTCCTCCAGCCGG 0: 1
1: 1
2: 4
3: 39
4: 377
902449973_902449983 -1 Left 902449973 1:16490844-16490866 CCCTCCCTGTTGTGCCCCCACCT No data
Right 902449983 1:16490866-16490888 TCTGCGGCTCCTCCTCCAGCCGG 0: 1
1: 1
2: 4
3: 39
4: 377
902449975_902449983 -5 Left 902449975 1:16490848-16490870 CCCTGTTGTGCCCCCACCTCTGC 0: 1
1: 1
2: 1
3: 24
4: 561
Right 902449983 1:16490866-16490888 TCTGCGGCTCCTCCTCCAGCCGG 0: 1
1: 1
2: 4
3: 39
4: 377
902449969_902449983 17 Left 902449969 1:16490826-16490848 CCATGCTGCCAGCCCTGGCCCTC No data
Right 902449983 1:16490866-16490888 TCTGCGGCTCCTCCTCCAGCCGG 0: 1
1: 1
2: 4
3: 39
4: 377
902449974_902449983 -2 Left 902449974 1:16490845-16490867 CCTCCCTGTTGTGCCCCCACCTC 0: 1
1: 0
2: 0
3: 39
4: 372
Right 902449983 1:16490866-16490888 TCTGCGGCTCCTCCTCCAGCCGG 0: 1
1: 1
2: 4
3: 39
4: 377
902449967_902449983 25 Left 902449967 1:16490818-16490840 CCAGGGGGCCATGCTGCCAGCCC No data
Right 902449983 1:16490866-16490888 TCTGCGGCTCCTCCTCCAGCCGG 0: 1
1: 1
2: 4
3: 39
4: 377
902449976_902449983 -6 Left 902449976 1:16490849-16490871 CCTGTTGTGCCCCCACCTCTGCG 0: 1
1: 0
2: 0
3: 12
4: 172
Right 902449983 1:16490866-16490888 TCTGCGGCTCCTCCTCCAGCCGG 0: 1
1: 1
2: 4
3: 39
4: 377
902449966_902449983 26 Left 902449966 1:16490817-16490839 CCCAGGGGGCCATGCTGCCAGCC No data
Right 902449983 1:16490866-16490888 TCTGCGGCTCCTCCTCCAGCCGG 0: 1
1: 1
2: 4
3: 39
4: 377
902449970_902449983 9 Left 902449970 1:16490834-16490856 CCAGCCCTGGCCCTCCCTGTTGT No data
Right 902449983 1:16490866-16490888 TCTGCGGCTCCTCCTCCAGCCGG 0: 1
1: 1
2: 4
3: 39
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902449983 Original CRISPR TCTGCGGCTCCTCCTCCAGC CGG Intergenic
900115677 1:1026841-1026863 ACAGAGCCTCCTCCTCCAGCGGG - Intronic
900244285 1:1630338-1630360 TCTGCAGCTCCTCCACCAGCTGG - Exonic
900385484 1:2408697-2408719 CCTGCAGCTCCTGCTCCAGGGGG + Exonic
900495406 1:2973862-2973884 CCTGGAGCTCCTCCTGCAGCCGG + Intergenic
900963575 1:5941911-5941933 GCTGGGGCTCCTCCTCCTGCAGG + Intronic
901567539 1:10131050-10131072 GGCCCGGCTCCTCCTCCAGCTGG + Intronic
901816012 1:11794020-11794042 GCAGCAGCTCCTCCTTCAGCAGG + Exonic
902089605 1:13892957-13892979 TCTCCGGCTCATCCTCCACTCGG - Intergenic
902449307 1:16486502-16486524 CCCGCAGCTGCTCCTCCAGCTGG + Intergenic
902449983 1:16490866-16490888 TCTGCGGCTCCTCCTCCAGCCGG + Intergenic
902468701 1:16633217-16633239 CCCGCAGCTGCTCCTCCAGCTGG + Intergenic
902504479 1:16930324-16930346 TCTGCTGCTCCTCCTCCAGCCGG - Exonic
902505441 1:16936775-16936797 CCCGCAGCTGCTCCTCCAGCTGG - Exonic
902506863 1:16944214-16944236 CCTCCTGCTCTTCCTCCAGCCGG - Exonic
902511951 1:16971503-16971525 GCTGCGCATCCACCTCCAGCTGG - Exonic
902990360 1:20183465-20183487 TCTGCTGCTCCTTCACCAGGGGG + Intergenic
903037078 1:20499896-20499918 TCTGCGCCTCATTCTCCAGGAGG + Exonic
903154421 1:21434441-21434463 CCTGCAGCTGCTCCTCCAGCTGG - Intergenic
903189532 1:21649025-21649047 GCTGCTGCTTCACCTCCAGCAGG - Intronic
903229709 1:21914382-21914404 TCTGAGGCTCCTCCTGCCTCTGG - Intronic
903391946 1:22970926-22970948 TCTGGGGTTACTCCTCCAACAGG - Intergenic
903543271 1:24108537-24108559 CCTTCTGCTCCTCCTCCTGCCGG + Exonic
904026240 1:27505342-27505364 TCTGCTGCTCCCGCCCCAGCCGG + Intergenic
904479542 1:30785374-30785396 AAGGCGGCTGCTCCTCCAGCAGG + Intergenic
904872526 1:33627794-33627816 TCTCCAACTCCTCCTCCAGATGG + Intronic
904944875 1:34191986-34192008 TCTGCGGCTCCAGCTCCACGCGG - Intronic
905259893 1:36709761-36709783 TCTCAGACTCCTCCTCCAGGAGG - Intergenic
906154664 1:43606870-43606892 TCTCCGGCTCCTCCTGCTGCTGG - Exonic
906749066 1:48242562-48242584 TCTGCCGCTCCACCTCCTGCAGG - Exonic
909413394 1:75379064-75379086 TCTTGGGCTCCTTCTCCAGGTGG - Intronic
910633746 1:89384208-89384230 TCTGCAGCTTCTCCTTCAGTTGG - Exonic
914779369 1:150770982-150771004 GCTGCTGCTCCTGCTCCTGCTGG - Intergenic
914878620 1:151530605-151530627 TCTGCTGCTCCTGCCCCAGGCGG - Exonic
915321915 1:155061035-155061057 CCAGCAGCTCCTGCTCCAGCTGG - Intronic
915402493 1:155633845-155633867 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
916009603 1:160692753-160692775 TCTTGGGCTCCTTCTCCAGGTGG - Intronic
917345213 1:174022270-174022292 GCTGAGGCTGCTCCTGCAGCAGG + Exonic
917423749 1:174892084-174892106 TCTGCGACTACACCTCCAACCGG + Intronic
919743214 1:200992766-200992788 TCTGCAGCTCAGCCTTCAGCAGG - Intronic
920437891 1:205959999-205960021 TCTGAGCCTCCTCCTGCAACAGG + Intergenic
920857600 1:209675631-209675653 TCTCCTGCTGCTCCTCCTGCAGG + Exonic
921048234 1:211492305-211492327 TGTCCGCTTCCTCCTCCAGCCGG + Exonic
922194926 1:223351627-223351649 TCTGTGCCCTCTCCTCCAGCTGG - Intronic
923299588 1:232629638-232629660 GCGGCGGCTCCTCTTCCAGCCGG + Intergenic
1063531046 10:6831647-6831669 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1064203253 10:13301569-13301591 TCTGCGGCTCGTCCTGCTGCAGG + Intronic
1064299840 10:14113829-14113851 TCTCCTCCTTCTCCTCCAGCAGG + Intronic
1065407745 10:25388606-25388628 CATGCTGCTCCTCCACCAGCAGG - Intronic
1066659966 10:37728927-37728949 CCTGCTTCTCCTCCTCTAGCTGG - Intergenic
1067031335 10:42880148-42880170 GCTGTGGCTGCTCCTCCCGCGGG - Intergenic
1067087161 10:43249001-43249023 TCTGAGGAGCCTTCTCCAGCTGG - Intronic
1067661469 10:48239079-48239101 TCTGGCTCTCCTCCACCAGCAGG - Intronic
1067750834 10:48969938-48969960 GCAGGAGCTCCTCCTCCAGCAGG - Intronic
1069881996 10:71598933-71598955 TCTGGGGCTGAGCCTCCAGCTGG + Intronic
1070853290 10:79584751-79584773 TCTGAATCTCCACCTCCAGCAGG - Intergenic
1072947888 10:99826926-99826948 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
1073513448 10:104057048-104057070 CCTGCGGCTCCTGCTGCAGCTGG - Exonic
1075600923 10:123768579-123768601 TCCGCGTCTCCTCCACCAGGTGG + Exonic
1076082620 10:127597349-127597371 ACTGGGGCTCCATCTCCAGCTGG + Intergenic
1076587572 10:131559875-131559897 CCAGGGGCTCCTCCTCCAGCCGG - Intergenic
1076614358 10:131746336-131746358 TCTGCCGCTCCCCCTGCCGCAGG - Intergenic
1076668863 10:132108222-132108244 TCAGCAGCTTCTGCTCCAGCAGG - Intronic
1077011038 11:379484-379506 CCTGCAGCTCCAGCTCCAGCAGG - Exonic
1077103065 11:830647-830669 TCTGCAGCTCCAGCTCCAGACGG - Exonic
1077301096 11:1847297-1847319 TCTGCGGCTGCCCCTCCGGCAGG + Intergenic
1077521431 11:3037675-3037697 CCTGCTCCTCCTTCTCCAGCTGG + Intronic
1078067924 11:8090074-8090096 TCTTCTGCTTCTGCTCCAGCAGG - Exonic
1078289451 11:9993738-9993760 CCTGTGGCTCCTCCTTGAGCAGG + Intronic
1079325915 11:19492443-19492465 TCTTCGTCTCCTCATCCATCTGG + Intronic
1079377466 11:19906372-19906394 TTTGCAGCTCCTCCTTCAGTAGG - Intronic
1080394397 11:31876398-31876420 TCTTTGGCTCCTCCTCAAGAGGG - Intronic
1082050928 11:47769873-47769895 TCTGCGGCTCGTCCTGCTACAGG + Intergenic
1082084788 11:48041018-48041040 CCTCCTGCTCCTCCTCCACCTGG + Intronic
1082678283 11:56137286-56137308 TCGGCGGCTCTGCCTCCTGCTGG - Exonic
1082695628 11:56360657-56360679 TCGGCGGCTCTGCCTCCTGCTGG + Exonic
1083661822 11:64254942-64254964 TCATCAGCTTCTCCTCCAGCCGG - Exonic
1083783504 11:64930608-64930630 TCTGGAGCTCCTGCTGCAGCAGG - Intronic
1083993730 11:66261897-66261919 GCTGCTTCTCCTCCTCGAGCTGG - Exonic
1084149896 11:67283169-67283191 TCTGCAGCAACCCCTCCAGCAGG - Exonic
1084150322 11:67285101-67285123 TCTGCGTCTCCTCCACCGACTGG - Exonic
1085253925 11:75161688-75161710 TCTGCGGCTCCACTTCCTGCCGG - Intronic
1085666140 11:78417416-78417438 GCTGCGGCTCCTGCTCCGCCAGG - Intronic
1087228798 11:95635802-95635824 TGTCCTGCTCATCCTCCAGCTGG - Intergenic
1087723936 11:101697041-101697063 TCTTGGGCTCCTTCTCCAGGTGG - Intronic
1088706763 11:112470947-112470969 TCTGTGGCTCCAGCTCCTGCTGG + Intergenic
1089621204 11:119723404-119723426 TCTGCTGCTCTCCCTCCACCAGG + Intronic
1089666447 11:120023320-120023342 TCTGAGACTCCACCTCCAGGAGG + Intergenic
1089846745 11:121464744-121464766 CCTGCGGCTGTTTCTCCAGCTGG + Intronic
1091833867 12:3570484-3570506 TCTGCGGTTCCTGCCCCAACAGG + Intronic
1092064157 12:5575874-5575896 GCTGCGTCCCCTCCTTCAGCTGG + Exonic
1092570377 12:9715059-9715081 GCTGCAGCTCCTCCTCATGCAGG + Intergenic
1095955148 12:47801770-47801792 TCTGCGCCTCCTCCCTCTGCTGG - Intronic
1096188615 12:49600094-49600116 CCTGATGCTCCTGCTCCAGCAGG + Exonic
1096529789 12:52235310-52235332 TCCGCAGCTCCGCCTCCAGGCGG - Exonic
1096532749 12:52252263-52252285 TCTGCTCCTCGCCCTCCAGCAGG + Intronic
1096537904 12:52287103-52287125 TCTGCTCCTCGCCCTCCAGCAGG + Exonic
1096540867 12:52306257-52306279 TCTGCTCCTCGCCCTCCAGCAGG - Exonic
1096542505 12:52315894-52315916 TCTGCTCCTCGCCCTCCAGCAGG + Exonic
1096684121 12:53276668-53276690 CCTGCAGCTCCTCCCTCAGCAGG - Exonic
1097331245 12:58334915-58334937 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1098484250 12:71002129-71002151 CCTGTGGCTCCACCTCCAGCTGG - Intergenic
1100566159 12:95796182-95796204 TCTTAGGCTCCTCTTCCAACAGG + Intergenic
1100781222 12:98028650-98028672 TATGCTGCTCATCATCCAGCAGG + Intergenic
1101963184 12:109265154-109265176 TCTGCGCCGCCTCCTCCTGGAGG + Exonic
1102058635 12:109915495-109915517 TCTCCGCCTCCTGCTGCAGCAGG - Exonic
1102062799 12:109946797-109946819 TTTTCAGCTCCTCCTCAAGCAGG - Intronic
1102386858 12:112517245-112517267 TCTGGGGCTGCAGCTCCAGCAGG - Intergenic
1102407511 12:112686551-112686573 TGTGCCTCTCATCCTCCAGCAGG - Intronic
1103019932 12:117525841-117525863 TCTGAGGCTCCTACAGCAGCTGG + Intronic
1103850733 12:123931447-123931469 TCTGAGGCTGCAGCTCCAGCAGG - Exonic
1104257606 12:127154034-127154056 TCTACGGGACCTCCTCCATCAGG + Intergenic
1104601212 12:130154688-130154710 TTTTCTGTTCCTCCTCCAGCAGG - Intergenic
1105788153 13:23769981-23770003 TCTGCGGCGTCCCCACCAGCAGG + Intronic
1105858910 13:24392766-24392788 GCTGCTGCTCCCCCTCCTGCAGG + Intergenic
1106242156 13:27920864-27920886 ACTACAGATCCTCCTCCAGCAGG + Intronic
1106683445 13:32031588-32031610 TCGGCCGCTCCTCCTCCTCCGGG - Exonic
1110220817 13:73070912-73070934 TCTGTGGACCCTCCTGCAGCAGG - Intronic
1110807947 13:79779962-79779984 TCTGTTCCTCCTCCTCCCGCTGG + Intergenic
1112374472 13:98825873-98825895 TCCCCGGCTCCTCCTCAGGCAGG + Exonic
1112926362 13:104679814-104679836 TCTGCAGCTCCTCCACCTGCAGG - Intergenic
1119951661 14:78751781-78751803 GCTACTGCTGCTCCTCCAGCAGG - Intronic
1120789167 14:88563294-88563316 GCTGCGGCTCCTCCTCGTCCAGG + Intronic
1121440341 14:93944874-93944896 CCTTCAGCTTCTCCTCCAGCTGG + Intronic
1121622781 14:95361699-95361721 TGAGAGGCTCCTCCTCCAGAAGG - Intergenic
1121790250 14:96693917-96693939 TTTGGGGCTCCTCCGCCAGATGG - Intergenic
1122436758 14:101706111-101706133 GCGGCGGCTCAGCCTCCAGCAGG - Intergenic
1124781601 15:32641648-32641670 GCCCCGGCCCCTCCTCCAGCAGG - Intergenic
1125574339 15:40745051-40745073 TGTGCTGCCCCTCCTGCAGCAGG - Exonic
1126408704 15:48349730-48349752 CCTGCGTCTTCACCTCCAGCAGG + Intergenic
1128344108 15:66842769-66842791 CCAGCGGCTCCTTCCCCAGCGGG - Intergenic
1128736135 15:70055012-70055034 GCTGCTGCGCCGCCTCCAGCTGG - Intronic
1129203793 15:74023299-74023321 TCTGGGGCTCCTCCTGGCGCAGG - Exonic
1129789054 15:78328611-78328633 TCTTCTGTTCCTCCTGCAGCTGG + Intergenic
1129870059 15:78934353-78934375 GCTGCGGCCCCTCCCCTAGCAGG - Intronic
1130269776 15:82440147-82440169 TCTGGGGCTCCTCATTCAGTGGG - Intergenic
1130282410 15:82530598-82530620 TCTGGGGCTCCTCATTCAGTGGG - Intergenic
1130462115 15:84167448-84167470 TCTGGGGCTCCTCATTCAGTGGG - Intergenic
1130490562 15:84427325-84427347 TCTGGGGCTCCTCATTCAGTGGG + Intergenic
1130502150 15:84506095-84506117 TCTGGGGCTCCTCATTCAGTGGG + Intergenic
1131206159 15:90449576-90449598 ACTGCAGCTCCTCCTTCTGCAGG - Exonic
1131830005 15:96348070-96348092 AGTGCGGCCCCTTCTCCAGCGGG + Intergenic
1132865226 16:2089906-2089928 TGTGCAGCTGCTGCTCCAGCTGG + Exonic
1134625199 16:15718371-15718393 CCTCCAGCTCCTCCTCCAGCTGG + Exonic
1134626226 16:15724724-15724746 TGTTCCGCTCCTCCTCCAGCTGG + Exonic
1136024521 16:27461235-27461257 TCTGCCGAGCCTCCTGCAGCAGG - Exonic
1136285595 16:29238712-29238734 CCTGCGACTCCTTCCCCAGCAGG + Intergenic
1136989412 16:35142961-35142983 CCTGAAGCTCCTCCTCCACCGGG + Intergenic
1138530353 16:57631303-57631325 ACTGCGGACCGTCCTCCAGCCGG + Intronic
1138567009 16:57840950-57840972 TCTGGCGATCCTCCTCCACCAGG + Intronic
1139509134 16:67416404-67416426 GCTCCGGCTCCGGCTCCAGCAGG + Exonic
1139734134 16:68972874-68972896 TCTGCTGCTGCTCCTCCTGGTGG - Intronic
1139952300 16:70678329-70678351 TCTCCGTCTCCTCCAGCAGCAGG + Exonic
1140328929 16:74033613-74033635 TTTGCGGCTCCTGCTCCACCTGG + Intergenic
1141797795 16:86286625-86286647 CCTGCGGCCCCTCCTCCCGCTGG - Intergenic
1141984376 16:87570538-87570560 TCTGAGGCCCCTTCTCCAACTGG - Intergenic
1142564385 17:830287-830309 CGTGGGGCTCCTCCTCCAGTGGG + Intronic
1143125319 17:4638216-4638238 CCTCCAGCTCCTTCTCCAGCTGG + Exonic
1143403185 17:6658893-6658915 CCTCCAGCTCCTTCTCCAGCTGG - Intergenic
1143471154 17:7177050-7177072 CCCGCAGCTCCTCCTGCAGCTGG + Exonic
1144290743 17:13823766-13823788 ACTGCTGTTCCTCCTCCACCTGG - Intergenic
1144676369 17:17164831-17164853 CCTCCAGCTGCTCCTCCAGCTGG - Intronic
1144676555 17:17165926-17165948 CCTGCCTCTCCTGCTCCAGCTGG - Intronic
1146375159 17:32288863-32288885 TCAGCCCCTTCTCCTCCAGCAGG - Exonic
1146714045 17:35068785-35068807 TCTCCTCCTCCTCCTCCATCGGG - Intronic
1146718108 17:35103324-35103346 TCTGCTTCTCCTCCTCCTGCAGG - Exonic
1146905322 17:36614305-36614327 TCTGGAGCACCTCCCCCAGCAGG - Intergenic
1146948659 17:36890961-36890983 TCTGCAGCTCCTGCACCAGATGG - Intergenic
1147239287 17:39079992-39080014 TGAGCTGCTCCTCCTGCAGCAGG + Intronic
1147754828 17:42761333-42761355 GCTCCGCCTCCTCCTCCTGCTGG + Exonic
1147969325 17:44211128-44211150 GCTGCTGCTCCTCCTCAGGCAGG + Exonic
1147978937 17:44262981-44263003 TCTCCTGGTCCTCCTCCAGAGGG + Intronic
1149266375 17:54932074-54932096 TCTGCGGCTCGTCCTGCTACAGG - Intronic
1149567428 17:57650031-57650053 TCTGATGCTCCACCTCCAGCAGG + Intronic
1149629991 17:58114764-58114786 TGTGTCTCTCCTCCTCCAGCAGG + Intergenic
1150008861 17:61486830-61486852 TGGGCTGCTACTCCTCCAGCAGG - Intergenic
1150313094 17:64145735-64145757 TCAGCGACTCCACCGCCAGCTGG - Intergenic
1151587201 17:75016780-75016802 ACTGTGGCTCCCCCTCCCGCTGG + Intronic
1151746522 17:76014576-76014598 TCTGGGCCTCGTCCTCCTGCAGG - Exonic
1151784162 17:76266790-76266812 CCTGCCCCTCCTCCCCCAGCAGG - Intronic
1151963433 17:77419325-77419347 CCTGTTACTCCTCCTCCAGCTGG - Intronic
1152105213 17:78324736-78324758 TGTGCGGCACCTCCTCCTCCTGG + Intergenic
1152198346 17:78930509-78930531 TCTGTGCCTCCCCATCCAGCCGG + Intergenic
1152481061 17:80553229-80553251 TGTGCTGCTCCTTCTCCTGCAGG + Intronic
1152775893 17:82201800-82201822 TCCCCTGCGCCTCCTCCAGCTGG + Exonic
1153171931 18:2326735-2326757 TCTCCAGCTCCTCATCCAGGGGG + Intergenic
1153895105 18:9551649-9551671 TTTGGGGCCCCTCCACCAGCAGG - Intronic
1154492998 18:14935363-14935385 TTTGTGGCTGCTCCTCCAGAAGG + Intergenic
1156448741 18:37254480-37254502 TCTGGGCCTCCTCCGACAGCCGG - Intronic
1157867096 18:51196930-51196952 CCAGCTCCTCCTCCTCCAGCAGG + Exonic
1159579744 18:70221445-70221467 TCTGCACCTCCCCCTCCACCCGG - Intergenic
1159590168 18:70325419-70325441 TCTGCGGTTCCTCCTCAAGTGGG + Exonic
1160887897 19:1360498-1360520 TCTTGGGCACCACCTCCAGCTGG - Exonic
1161435097 19:4258367-4258389 TCCGCCGCTCCTCCTCCGACAGG - Exonic
1161687110 19:5708280-5708302 TCTGCAGCTCTTTCTGCAGCTGG - Intronic
1161739672 19:6013026-6013048 ACTGCGTGTCCTCCTGCAGCCGG + Exonic
1163641603 19:18465454-18465476 TCCGCGTCTCCTCCTCCGCCTGG + Exonic
1164153888 19:22576902-22576924 TCTTGGGCTCCTTCTCCAGGTGG - Intergenic
1164371142 19:27645421-27645443 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1164599263 19:29549820-29549842 ACGGAGGCTCCTCCTTCAGCTGG + Intronic
1165326121 19:35115509-35115531 TCTCCTGCTCCTCCTCCTCCAGG - Intergenic
1165329719 19:35134740-35134762 ACTACGTCTCCTCCTCCACCAGG + Exonic
1165510935 19:36266385-36266407 CCTGAAGCTCCTCCTCCACCGGG + Intergenic
1165914227 19:39247980-39248002 TCAGCGCCTCTTCCTCCTGCGGG + Intergenic
1166111801 19:40627244-40627266 TCTGAGGCTCCTGCGCCACCTGG + Exonic
1166812213 19:45521380-45521402 TCTGCTGCTCCACCTCCTCCGGG - Exonic
1167568622 19:50272696-50272718 CCTGCAGCTCCTCCTCCTTCCGG - Exonic
1167578514 19:50329047-50329069 TCTGCGTCTCGTCCTTCCGCGGG - Exonic
1168126775 19:54288301-54288323 TCTGCGGCTCGTCCTGCTACAGG - Intergenic
1168275824 19:55277780-55277802 TCTGCTCCACCTCCTCCCGCTGG + Exonic
1168309690 19:55454270-55454292 TCTGCAACTCCTGCCCCAGCTGG + Intronic
1168422566 19:56214355-56214377 TGTGCGGCAGCTCCTCTAGCTGG + Intergenic
1168637066 19:58004464-58004486 CCTACAGCTCATCCTCCAGCAGG + Intronic
1202701939 1_KI270712v1_random:171205-171227 TCTGCCTATACTCCTCCAGCAGG + Intergenic
926315634 2:11707670-11707692 CCTGCAGCTCCACCTCCAGTGGG - Intronic
927198673 2:20565320-20565342 ACTGTGGCTCCTCCACCAGATGG + Intronic
927506617 2:23619217-23619239 TCTGTGACTCTTCCTGCAGCAGG + Intronic
928327680 2:30333116-30333138 ACTCCCCCTCCTCCTCCAGCAGG - Intergenic
929995628 2:46824725-46824747 TCTGGGCCTCCAACTCCAGCAGG - Intronic
931116924 2:59175011-59175033 CCTGCCGCCCCTGCTCCAGCTGG + Intergenic
932087431 2:68774718-68774740 CTTGCGGCCCCTCCTCTAGCCGG + Intronic
935971062 2:108531443-108531465 TCTGCGGCTCATCCTGCTACAGG + Intergenic
937127264 2:119482582-119482604 GCTCCGGCTCCTCCTCTTGCAGG - Intronic
938795988 2:134718782-134718804 CCTGCCGCTCCTCCTCCAGCTGG + Exonic
940913369 2:159228519-159228541 TCTGAGGCTGCCCCTCCACCGGG + Intronic
941493220 2:166168301-166168323 TGTCCTGCTCCTACTCCAGCTGG + Intergenic
943687570 2:190834907-190834929 TCTGCTGCTCCTCGTGGAGCAGG + Intergenic
947722092 2:232376470-232376492 GCTTTGGCTCTTCCTCCAGCCGG - Intergenic
948460358 2:238127359-238127381 GCCGCGGCCCCTCCTGCAGCAGG - Intronic
948658219 2:239490019-239490041 GCTGCGGCTCTCTCTCCAGCAGG + Intergenic
949057017 2:241933184-241933206 TCAGCTGGTCCTCCTCCACCCGG + Intergenic
1169209035 20:3755447-3755469 GGTGCGTCCCCTCCTCCAGCAGG - Exonic
1170597213 20:17815102-17815124 CCCCCGGCTCCTCCTCCTGCAGG - Intergenic
1171336464 20:24389829-24389851 TCTGAGCCACTTCCTCCAGCAGG + Intergenic
1171465234 20:25323286-25323308 TCTGCAGCCCCTCCAGCAGCAGG - Intronic
1171544686 20:25991090-25991112 CCTGAAGCTCCTCCTCCACCAGG + Intergenic
1172191212 20:33063014-33063036 TCTGAGGCTCCCACTCCAGTGGG + Intronic
1172506350 20:35465802-35465824 TCTGTTGCTCCTCCTCCAATCGG - Exonic
1172838376 20:37887357-37887379 TCTGAGGCTCCTCCTCACCCTGG - Intergenic
1172969755 20:38864873-38864895 TCTGCAGCTCCAGCTCCAGGAGG - Intronic
1173250886 20:41363707-41363729 TCTGAGGCTCAGGCTCCAGCTGG + Exonic
1173283169 20:41647546-41647568 TCTTGGGCTCCTCTGCCAGCTGG + Intergenic
1175521596 20:59605426-59605448 TCTGCCTCTCTTCCCCCAGCCGG - Intronic
1175643665 20:60652781-60652803 AGTGTGGCTGCTCCTCCAGCAGG - Intergenic
1175889431 20:62309791-62309813 TCTGCGCGTCCACCTCCAGCCGG + Exonic
1177248934 21:18567808-18567830 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1178433626 21:32537727-32537749 TCTCCTGATCCTACTCCAGCTGG - Intergenic
1178672367 21:34603278-34603300 TCTCCGGCCCCTCCACAAGCTGG + Intronic
1178913903 21:36696599-36696621 CCCGAGGCTCCCCCTCCAGCAGG + Intergenic
1179893218 21:44348144-44348166 TTTGCTGCTCCTGCTCTAGCTGG + Intergenic
1180031403 21:45210958-45210980 TCTGAGGCTCCTTCCACAGCTGG + Intronic
1180231759 21:46430594-46430616 GCAGCTGCTCCTCCTCCAGCTGG - Exonic
1180235886 21:46459149-46459171 GCAGCGGCGCCGCCTCCAGCGGG - Exonic
1180837944 22:18940652-18940674 TCTTGGGCTCCTTCTCCAGGTGG - Intergenic
1180962974 22:19770640-19770662 CCTGCGGCGCACCCTCCAGCTGG + Intronic
1181064188 22:20297981-20298003 TCTGCTCCTCTTCCTCCTGCCGG - Intergenic
1181182134 22:21075769-21075791 GCTGCGGCTGCTTCTCAAGCAGG - Intergenic
1181403590 22:22666713-22666735 GCTGAGTCTCCTCCACCAGCTGG + Intergenic
1181413866 22:22745828-22745850 GCTGAGTCTCCTCCACCAGCTGG + Intronic
1181863218 22:25835305-25835327 TCCTGGGCACCTCCTCCAGCTGG - Exonic
1181939425 22:26463946-26463968 GCAGCGGCTCCTCAGCCAGCAGG + Exonic
1182442743 22:30373701-30373723 TCTGCAGCTGCTCCTCCACGCGG - Exonic
1182734190 22:32519518-32519540 TCTGTGGCTCCTCTTCCAACTGG - Intronic
1183076691 22:35431825-35431847 TGTGCCTCTCCTCCTCCAGGGGG + Intergenic
1183184790 22:36285714-36285736 CCTCCAGCTCCTCCTCCAGCTGG + Exonic
1183252092 22:36737410-36737432 TCTGCTTCTCCTCCTCAAACTGG - Intergenic
1183929813 22:41229595-41229617 CCTGAGGGTCGTCCTCCAGCAGG - Exonic
1184040670 22:41941367-41941389 TCTGCAGCTCCTGCTGCGGCGGG + Intronic
1184500502 22:44868651-44868673 TCTGCGGCTCGTCCTGCTACAGG - Intergenic
1184501601 22:44878070-44878092 TCTGCCCTTCCGCCTCCAGCCGG - Intergenic
949864154 3:8533318-8533340 TCTGCGAATCCAACTCCAGCTGG - Intronic
949892080 3:8740759-8740781 TCTGTGACTCCTCCTTCAGGAGG - Intronic
949943821 3:9174732-9174754 TCTGCTACTTCTCCTCCAGGGGG + Intronic
950030886 3:9852602-9852624 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
952511819 3:34065863-34065885 TCTGGGGCTGCTCCTCCATGGGG + Intergenic
952971925 3:38656740-38656762 CCTCTAGCTCCTCCTCCAGCTGG - Intergenic
954291781 3:49653709-49653731 GCTGTGGCTCCTTGTCCAGCTGG + Exonic
954465049 3:50649378-50649400 CCTGAGGCACCCCCTCCAGCTGG - Intergenic
954955728 3:54516980-54517002 TCTGGGGCTCCCACTCCTGCAGG - Intronic
955798282 3:62660580-62660602 TCTCTGGCTTCTCCTCCAGTAGG + Intronic
957792568 3:84959370-84959392 TCTTCTCCTCCTCCTCCTGCTGG - Intronic
959191022 3:103111969-103111991 TCTGCGCCCTCTCCTCCAGATGG + Intergenic
959539896 3:107525311-107525333 TCTCCTCCTCCTCCTCCCGCGGG - Intronic
959711896 3:109393896-109393918 TCTGCGGCTCTTCCTGCTACAGG + Intergenic
960028134 3:113031443-113031465 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
961296927 3:125892272-125892294 TCTTGGGCTCCTTCTCCAGTTGG - Intergenic
962415707 3:135179709-135179731 TCTGCCTCTCCTCCTCTTGCTGG - Intronic
962677733 3:137768969-137768991 TCTGCAGAACCTCCTCCTGCAGG - Intergenic
963695998 3:148566577-148566599 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
967026567 3:185569731-185569753 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
968503529 4:961737-961759 CCTGCCGCTCCACCTGCAGCCGG + Exonic
968508473 4:983473-983495 TCTGCAGCTCTCCCTCCTGCTGG - Intronic
968540752 4:1167213-1167235 TCTCAGCCTCCTCCTCCTGCAGG - Exonic
968703880 4:2069331-2069353 GCTGAGGCCCCTCCCCCAGCAGG + Intergenic
968876325 4:3269647-3269669 CCTCCTGCTCCTCCTCCTGCAGG + Intronic
969426975 4:7130171-7130193 TCAGCAGCTCCACCTCCTGCAGG - Intergenic
969494006 4:7515519-7515541 GCTGCTCCTCCTCCTCCATCCGG - Intronic
970502896 4:16696271-16696293 TCTGCAGCACCTGATCCAGCTGG - Intronic
972826217 4:42762073-42762095 TCTGCGGATGCTCCTGCTGCTGG + Intergenic
975473151 4:74793728-74793750 CCTGCTACTCCTCCTCCCGCTGG + Intronic
977323676 4:95549163-95549185 GCTGCGGCTGCTCCTGCTGCTGG - Exonic
977605200 4:98977394-98977416 TCTCCTCCTCCTCCTCCAACAGG - Intergenic
981270972 4:142846799-142846821 TCTGCGGCCCCTCTGCCCGCTGG + Intronic
981531848 4:145761465-145761487 TGTGCGTCTCCAGCTCCAGCTGG + Exonic
982876789 4:160660597-160660619 TCTTGGGCTCCTTCTCCAGGTGG - Intergenic
983930741 4:173450649-173450671 TCTGCAGTTCCTCCTGCAGGAGG - Intergenic
985844865 5:2336578-2336600 CCAGCAGCTCCTCCTGCAGCTGG + Intergenic
988380702 5:30494115-30494137 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
990528237 5:56649827-56649849 TCTGCAGCTGCTCCTCATGCTGG - Intergenic
992086688 5:73284088-73284110 TCTGTGGCTCCCTCCCCAGCTGG + Intergenic
993451884 5:88081762-88081784 TCTGCTTCTCCTTCTCCATCTGG + Intergenic
994648722 5:102500553-102500575 TTTGCTGCTCCTCCTTCAGTGGG - Intergenic
996405472 5:123098929-123098951 GCTGCGGCTCCTGCTCTACCGGG + Intronic
999952400 5:156664885-156664907 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
1000002038 5:157148283-157148305 TCTGCGGCTCTTCCTGCTACAGG - Intronic
1001476509 5:172054667-172054689 TCTGCCTCTTCTCCTCCTGCTGG + Exonic
1001556555 5:172641215-172641237 GCTCCGCCTCCTCCTCCCGCAGG + Intergenic
1002448970 5:179308400-179308422 TGCGCGGCTCCCCTTCCAGCTGG - Intronic
1002519051 5:179780508-179780530 TCTGCAGCCCTGCCTCCAGCAGG - Intronic
1002711114 5:181195514-181195536 CCTGCGGCTTCTCCTCGGGCCGG - Exonic
1003084937 6:3053583-3053605 CCTGCGGCTCCTACCCCGGCCGG - Intergenic
1003532317 6:6947982-6948004 TCTGCCCCTCCACCCCCAGCAGG - Intergenic
1003550940 6:7101471-7101493 TCTGCTGCTCCAGCTCCAGAGGG + Intergenic
1003624157 6:7727276-7727298 GCTGCTGCTCCTCCTGCTGCCGG - Exonic
1003690916 6:8352811-8352833 TCTGAGGCTCAGCTTCCAGCTGG + Intergenic
1006166732 6:32069790-32069812 CCTGCAGCTCCTCCCCCAGACGG + Intronic
1006688830 6:35861955-35861977 TCTGCTGTTCCTCTCCCAGCTGG - Intronic
1006793337 6:36717494-36717516 TCCCCAGCTCCTCCTGCAGCTGG + Intronic
1010392483 6:75353540-75353562 TCTCCCGCTCCTGCTCCAGCAGG + Exonic
1010592186 6:77724374-77724396 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
1010678080 6:78767754-78767776 TCTCAGGCTCCTGCTCCAGAGGG + Intergenic
1015086011 6:129292955-129292977 TCCGCGGCTGCTCCTCCTGTTGG - Intronic
1015274755 6:131372733-131372755 TCATCGGCTCCTCTTCCAGATGG + Intergenic
1017185468 6:151596403-151596425 CCTGCTTCTCCTCCTCCAGCTGG - Exonic
1018652347 6:166002850-166002872 TCTGCGGAGCCCCCCCCAGCTGG + Intergenic
1018769500 6:166958279-166958301 TCTGCCGCTCCTCCTGCCACAGG - Intergenic
1018887415 6:167951647-167951669 TCTCCCGCTCCTCCTCCAGGCGG - Exonic
1019169694 6:170125908-170125930 CCTGCTCCTCCTCGTCCAGCTGG + Intergenic
1019403822 7:872060-872082 TCTGTGGCCCCTCCTCCTGCTGG + Intronic
1019976860 7:4589897-4589919 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1019977795 7:4598400-4598422 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1020081406 7:5287909-5287931 CCTCCGCCGCCTCCTCCAGCTGG - Exonic
1022294955 7:29042163-29042185 TCTGCTGCTCCTCCTCCACATGG - Intronic
1024222675 7:47300737-47300759 GCCTCGGCACCTCCTCCAGCTGG - Intronic
1025197507 7:56944239-56944261 CCTCCGCCGCCTCCTCCAGCTGG + Intergenic
1025296082 7:57776155-57776177 CCTGAAGCTCCTCCTCCACCAGG + Intergenic
1025674440 7:63632700-63632722 CCTCCGCCGCCTCCTCCAGCTGG - Intergenic
1025811298 7:64877338-64877360 TAATCGCCTCCTCCTCCAGCGGG + Intronic
1026335030 7:69386830-69386852 TCTGCAGCCCCTCTTGCAGCTGG + Intergenic
1026681146 7:72467458-72467480 TCTCCGGCTCCTCCTCCACCTGG - Intergenic
1027669237 7:81075400-81075422 TCTCTGGCTCCTCTTCCAGGTGG + Intergenic
1027671786 7:81109289-81109311 TCTCCTTCTCCTCCTCCATCTGG - Intergenic
1028164030 7:87517413-87517435 TGTGTGCCTCATCCTCCAGCAGG - Intronic
1029524912 7:101088494-101088516 TCTTCGGCTCATCCTCCCTCCGG - Exonic
1029967144 7:104751790-104751812 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
1030176558 7:106660582-106660604 TCTACGGCTACTCCTCCTGCCGG - Exonic
1032071398 7:128809581-128809603 TGTGCAGCTCTTCCTGCAGCTGG - Exonic
1033541412 7:142359068-142359090 TCTGTGCATCCTCCTGCAGCAGG + Intergenic
1034255479 7:149722503-149722525 TCTGTGGCTCTTCCTCCTGCTGG - Exonic
1034330930 7:150281682-150281704 TCTGCGGACCCTCCTCAGGCGGG - Intronic
1035110947 7:156481248-156481270 CATGACGCTCCTCCTCCAGCTGG + Intergenic
1035316851 7:158001922-158001944 CCTGGAGATCCTCCTCCAGCCGG + Intronic
1035418031 7:158705395-158705417 CCTGCAGTTGCTCCTCCAGCAGG + Intergenic
1036204471 8:6794870-6794892 TCTGCAGAGCCTCCTCCACCAGG + Intergenic
1036292403 8:7505345-7505367 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
1036648044 8:10624462-10624484 TCTGCATCACCTCCTCCAGGAGG - Intronic
1037581867 8:20250084-20250106 CCTGCAGCTCCTGCTCCAGCAGG + Exonic
1039804297 8:40985292-40985314 CCTGCTGATCCTCCTCAAGCGGG + Intergenic
1039971104 8:42322440-42322462 TCTGCCGCTTCTCCTGCAGCCGG - Exonic
1041125802 8:54637078-54637100 TCTGGTGCTCTTCCTTCAGCAGG + Intergenic
1045724745 8:105159437-105159459 TCTCCGCCTCCTCCCCCAACCGG + Intronic
1046888538 8:119396308-119396330 ACTCCGGCTCACCCTCCAGCTGG + Intergenic
1047213897 8:122861900-122861922 CCTGGGGCGCCTCCTCCCGCCGG + Intronic
1047389478 8:124438448-124438470 ACTGTGGCTCTCCCTCCAGCAGG - Intergenic
1048351254 8:133618542-133618564 TGTGGTGCTCCTCATCCAGCAGG + Intergenic
1048947368 8:139461961-139461983 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1049204569 8:141357785-141357807 CATGCAGCTCCTCGTCCAGCCGG + Exonic
1049224873 8:141445391-141445413 TCTCGGGCTCCTCATACAGCTGG - Intergenic
1049224885 8:141445469-141445491 TCTCGGGCTCCTCATACAGCTGG - Intergenic
1049224890 8:141445504-141445526 TCTCGGGCTCCTCATACAGCTGG - Intergenic
1049224895 8:141445539-141445561 TCTCGGGCTCCTCATACAGCTGG - Intergenic
1049224905 8:141445617-141445639 TCTCGGGCTCCTCATACAGCTGG - Intergenic
1049224910 8:141445652-141445674 TCTCGGGCTCCTCATACAGCTGG - Intergenic
1049224915 8:141445687-141445709 TCTCGGGCTCCTCATACAGCTGG - Intergenic
1049224920 8:141445722-141445744 TCTCGGGCTCCTCATACAGCTGG - Intergenic
1049224930 8:141445800-141445822 TCTCGGGCTCCTCATACAGCTGG - Intergenic
1049224956 8:141445952-141445974 TCTCGGGCTCCTCATACAGCTGG - Intergenic
1049337709 8:142095434-142095456 TCTGTGCCTCATCCTCTAGCAGG - Intergenic
1049343663 8:142127212-142127234 CCTGGGCCTCCTCCTCCAGCTGG + Intergenic
1049441837 8:142613140-142613162 TCTCCGCCTCATCCTCCACCGGG + Exonic
1049615748 8:143575196-143575218 ACTGCGGCTCTGCCTCCAGCAGG - Exonic
1049681990 8:143923298-143923320 GCTGCAGCTCCTCGTCCAGCAGG + Exonic
1049753182 8:144295398-144295420 TCTCAGGCTCCTCAGCCAGCTGG - Intronic
1049998464 9:1052069-1052091 GCTGCCGCTCCACCACCAGCAGG - Exonic
1053142184 9:35689253-35689275 CCTGCTGCTCCTCCTCCAGCTGG + Exonic
1056664731 9:88572441-88572463 GTAGCGGCTCCTCCTGCAGCTGG + Intronic
1057139729 9:92719123-92719145 TCTTTAGCTCCTTCTCCAGCCGG + Exonic
1057164483 9:92914991-92915013 CCTCCAGCTCCTTCTCCAGCTGG - Intergenic
1057605728 9:96496709-96496731 TCCGCTGCACCTCCTCCAGCGGG - Intronic
1057949653 9:99359581-99359603 TCCGTGGCTCCTCCTCCCACCGG - Intergenic
1060825161 9:126683565-126683587 ACTGCAGCTCATCCTTCAGCCGG + Intronic
1060827122 9:126693769-126693791 TCTGCTGCTCCTGCTGCTGCTGG - Exonic
1061203818 9:129151856-129151878 CCTGCGGCTCATCTTCTAGCAGG - Intergenic
1061252902 9:129437082-129437104 TCGGCGCCCCCTCCTCCCGCCGG - Intergenic
1061283701 9:129610814-129610836 TCTACGGCCCCTCCTCCAGGTGG - Intronic
1061798114 9:133100304-133100326 CCTCCGGCTCCTCCTCCTCCAGG + Exonic
1061927113 9:133811323-133811345 TCTGCTTCTCCACCACCAGCTGG + Intronic
1062407031 9:136401527-136401549 TATGCGCCTCCTGCTCCTGCTGG - Intergenic
1062416953 9:136456058-136456080 TCTGCCGCTCCACCTGCTGCAGG + Exonic
1062574380 9:137199672-137199694 TCCGGGGCTCCTCCTCCTGAGGG - Exonic
1186508054 X:10109940-10109962 GCTCCCGCTCCTCCTCCAGCCGG - Exonic
1187396557 X:18924418-18924440 TCTGCCCGTCATCCTCCAGCAGG + Exonic
1187684116 X:21799383-21799405 TCTGCAGCTCCTCCTTCTTCAGG - Intergenic
1190774938 X:53545060-53545082 TCTGTGGCTGCTCCTCAGGCAGG + Exonic
1193069817 X:77295864-77295886 TTTACGGCTTCTCCTGCAGCTGG - Intergenic
1198312078 X:135433794-135433816 CCTGCAGCTGCTCCTCCAGTTGG - Intergenic
1199846475 X:151695467-151695489 GCTGCTGCGCCTCTTCCAGCAGG - Intronic
1200800102 Y:7378734-7378756 TCTGCGGATCTTCCTCGCGCAGG - Intergenic
1201065556 Y:10091832-10091854 TCTGCGGCTCCTCCTGCTACAGG + Intergenic
1202367671 Y:24178228-24178250 TCTGGGGCTCCTCATTCAGTGGG - Intergenic
1202377164 Y:24247684-24247706 TCTGGGGCTCCTCGTTCAGTGGG + Intergenic
1202493616 Y:25422437-25422459 TCTGGGGCTCCTCGTTCAGTGGG - Intergenic
1202503112 Y:25491895-25491917 TCTGGGGCTCCTCATTCAGTGGG + Intergenic