ID: 902450043

View in Genome Browser
Species Human (GRCh38)
Location 1:16491110-16491132
Sequence GATGGTGACCCCCATGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902450031_902450043 14 Left 902450031 1:16491073-16491095 CCTCTTCTTGTACTGGAGAATGT 0: 1
1: 5
2: 0
3: 8
4: 145
Right 902450043 1:16491110-16491132 GATGGTGACCCCCATGGGTGGGG 0: 1
1: 0
2: 3
3: 21
4: 155
902450029_902450043 21 Left 902450029 1:16491066-16491088 CCGAGTACCTCTTCTTGTACTGG 0: 1
1: 6
2: 0
3: 9
4: 99
Right 902450043 1:16491110-16491132 GATGGTGACCCCCATGGGTGGGG 0: 1
1: 0
2: 3
3: 21
4: 155
902450028_902450043 27 Left 902450028 1:16491060-16491082 CCAGCTCCGAGTACCTCTTCTTG 0: 1
1: 4
2: 1
3: 5
4: 135
Right 902450043 1:16491110-16491132 GATGGTGACCCCCATGGGTGGGG 0: 1
1: 0
2: 3
3: 21
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902450043 Original CRISPR GATGGTGACCCCCATGGGTG GGG Intergenic
901465081 1:9416362-9416384 GATGGTGAAAGCCATGTGTGTGG - Intergenic
901908570 1:12436127-12436149 GATGGTGACCCCAAGGGGAGAGG - Intronic
902286554 1:15411343-15411365 GATGGGCACCCCCAGGCGTGTGG + Intronic
902370873 1:16006115-16006137 TCGGGTGACCCCCATGGGTGGGG + Exonic
902450043 1:16491110-16491132 GATGGTGACCCCCATGGGTGGGG + Intergenic
902472220 1:16656971-16656993 GATGGTGAGCCCCAGGGGTGGGG + Intergenic
902486583 1:16750475-16750497 GATGGTGAGCCCCAGGGGTGGGG - Intronic
902504422 1:16930085-16930107 GATGGTGAGCCCCAGGGGTTGGG - Intronic
903535350 1:24063053-24063075 GAGGGAGGCCCCCATGGGTCAGG + Intronic
904224607 1:29005639-29005661 GATGGACACCCACATGGATGGGG + Intronic
904659932 1:32076792-32076814 GATGGTGACCACCATCGTTCTGG + Exonic
906116299 1:43359334-43359356 GTTGGCGGCCCGCATGGGTGAGG - Exonic
908570380 1:65403829-65403851 GTTGATGAGCCCCATGAGTGCGG + Intronic
913003629 1:114606887-114606909 AATGGTGGCCCCCATGGGAAGGG - Intronic
913344154 1:117791435-117791457 GATGTTCACCCACATTGGTGAGG - Intergenic
914913405 1:151803853-151803875 GATGGTGACTACAATGGCTGAGG + Intronic
920442549 1:205990598-205990620 AAAGGTGACCCCCATGGGGTGGG + Intronic
922801343 1:228366077-228366099 GATGGTTACCTGCATGGATGGGG - Exonic
922890511 1:229058349-229058371 GTTGGTGAGCCCCCTGGGTAGGG + Intergenic
924910433 1:248506213-248506235 GATGGTGACCCCCTTAGTTTAGG + Intergenic
924913667 1:248541826-248541848 GATGGTGACCCCCTTAGTTTAGG - Intergenic
1064425385 10:15225140-15225162 GATCGTAAACTCCATGGGTGTGG + Intronic
1064904765 10:20333871-20333893 GATGCTCACCCTCATTGGTGAGG - Intergenic
1069921730 10:71819664-71819686 GATGGTGCCCCTCTTGGGTCTGG - Intronic
1073740288 10:106398841-106398863 TATTGTGAACTCCATGGGTGCGG + Intergenic
1076830937 10:132993918-132993940 GATGGTGACGGCAGTGGGTGGGG - Intergenic
1079039179 11:17046282-17046304 AACGGTGGCCCCCAGGGGTGCGG + Intergenic
1085784392 11:79438123-79438145 GATGGTGATGTGCATGGGTGGGG - Intronic
1089298672 11:117484788-117484810 GACTGGGACCCCCATGGGTCGGG + Intronic
1089864056 11:121616497-121616519 GCTGGTGACCGCCAGGGATGGGG - Intronic
1090707322 11:129350534-129350556 GATGGTCACCCACATTGTTGAGG - Intergenic
1091240194 11:134046936-134046958 GATGGTGACTCACCTGGCTGAGG - Intergenic
1094488237 12:30941755-30941777 GCTGGGGTGCCCCATGGGTGGGG - Intronic
1098183073 12:67869026-67869048 GTTGGTGACCCCTTTGGTTGGGG + Intergenic
1102008923 12:109606341-109606363 GGGGGTCACCCCCAGGGGTGGGG + Intergenic
1102953896 12:117047219-117047241 GATGGTGCCCTCCAGGGCTGTGG - Intronic
1104047428 12:125173254-125173276 TCTGGTCACCCCCAGGGGTGTGG - Intergenic
1104259895 12:127172753-127172775 GATGTTCACCCACATTGGTGAGG - Intergenic
1104367753 12:128193225-128193247 GATGCTGACACCCCTGAGTGTGG + Intergenic
1104754786 12:131262229-131262251 GATGCTGAAATCCATGGGTGCGG + Intergenic
1112331489 13:98480022-98480044 AATGGAGACCCTCACGGGTGAGG - Intronic
1114793223 14:25682447-25682469 GATGCTGACCCCATTGGGGGAGG + Intergenic
1115268582 14:31527130-31527152 GATGGTGGCGCCCATTGGGGAGG + Intronic
1118375789 14:65175853-65175875 GAAGGTGGACCCCATGGCTGGGG + Intergenic
1118469428 14:66061400-66061422 GAAGCTCACCCCCATTGGTGAGG + Intergenic
1122055961 14:99098471-99098493 GCTGGTGCCCACCATGGGAGAGG - Intergenic
1124249985 15:28100880-28100902 CATGGTGACCCCCATCCTTGTGG + Intergenic
1124364243 15:29061060-29061082 TATGGTGCCCCCCAGGAGTGTGG - Intronic
1128796300 15:70469233-70469255 GATGGTGAACTCCTTGGCTGGGG - Intergenic
1130059442 15:80559113-80559135 GATGGAGAGGCCCATGTGTGGGG - Intronic
1131178924 15:90227425-90227447 GATGCTGACTCCTGTGGGTGGGG + Intronic
1132731375 16:1363872-1363894 GCTGGGGAGCCCCAGGGGTGGGG - Exonic
1133662508 16:7933002-7933024 GATGGTGCCCACCAAGGTTGGGG + Intergenic
1133875724 16:9732492-9732514 GATGGTCATCCCCATGTGTCAGG - Intergenic
1134031737 16:10997446-10997468 GATGGTGATTCTCTTGGGTGGGG - Intronic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1135477098 16:22786314-22786336 GATGGTGATCCCCATGGGGATGG - Intergenic
1137400644 16:48151714-48151736 GATGGTTACCTCTAGGGGTGGGG + Intronic
1140595005 16:76398225-76398247 GATGGTGCCCACCCTGGTTGAGG + Intronic
1140664452 16:77214722-77214744 GATGGTGACACCCCTTGGTTTGG + Intergenic
1142996009 17:3760938-3760960 GCTGGTGGCCTCCAAGGGTGAGG - Intronic
1143479079 17:7218400-7218422 TATGGTGTCCTCCATGAGTGTGG - Intronic
1147442254 17:40454339-40454361 GATGGTGAAATCCAGGGGTGAGG - Intronic
1152383469 17:79954668-79954690 GAAGGGGGCACCCATGGGTGCGG - Intronic
1152805447 17:82353725-82353747 GAACGTGACCCCCAAGTGTGTGG + Intergenic
1152903070 17:82956462-82956484 GAGGGTGGCCTGCATGGGTGTGG - Intronic
1154001738 18:10487600-10487622 GAAGGTCACCCCCATGGATGCGG + Exonic
1157247374 18:46066597-46066619 GAAGGTGAGCCCCACGTGTGTGG + Intronic
1165833044 19:38738551-38738573 GTAAGTGTCCCCCATGGGTGGGG - Intronic
1202704616 1_KI270713v1_random:13765-13787 GATGGTGAGCCCCAGGGGTGGGG + Intergenic
925703630 2:6663246-6663268 GATAGTGACCTCCAAGGGTGTGG - Intergenic
926113772 2:10198169-10198191 GAAGATGCACCCCATGGGTGGGG - Intronic
927875649 2:26653625-26653647 GATGGTGGCCCCCTGGGGTGTGG - Intergenic
929601304 2:43206409-43206431 GATGGTGCCCACCAGGGGTGTGG + Intergenic
933694870 2:85210248-85210270 GATGGGGATGCCCATGTGTGTGG - Intronic
936595127 2:113840298-113840320 GATGGTGACCGCCAAGGGAGGGG + Intergenic
937429940 2:121829834-121829856 CATTGTGAACCCCATGGGTGTGG + Intergenic
938138641 2:128779413-128779435 AATGGTGTTCCCCATGGGAGTGG - Intergenic
943214515 2:185013127-185013149 GAGGCTGAACCCCTTGGGTGGGG - Intergenic
943555971 2:189404265-189404287 GATGGCTACCCACATTGGTGAGG - Intergenic
945969689 2:216223498-216223520 GATGGCCACCCACATGGGTGAGG - Intergenic
948199478 2:236119533-236119555 CATGGTCACCCCCAGGTGTGGGG + Intronic
1169266444 20:4170117-4170139 GATTGAGACCCGCATGGGTGAGG + Intronic
1170118991 20:12892150-12892172 GATGGGCACCCTCAAGGGTGGGG + Intergenic
1171207998 20:23296082-23296104 GCTCCTGACCCCCATGTGTGTGG + Intergenic
1172105683 20:32516036-32516058 GAGGGTCACTCCCATGGTTGAGG - Intronic
1174591021 20:51645196-51645218 GATGGTGGATCCCAGGGGTGGGG - Intronic
1175034300 20:55985174-55985196 GATGTTGAAGCCCAAGGGTGGGG + Intergenic
1175293892 20:57895749-57895771 GATGCTGACCCCCAGGGCTGGGG - Intergenic
1175409368 20:58756030-58756052 GAAGGTGATCCCCGTGGCTGGGG - Intergenic
1175696327 20:61105784-61105806 CCTGGTGCCCGCCATGGGTGTGG - Intergenic
1177655473 21:24011239-24011261 GATGGTGACTGCCATGACTGTGG - Intergenic
1177828398 21:26109145-26109167 GTTGGTGGCCACCATGAGTGGGG - Intronic
1178242491 21:30918666-30918688 GATTGTGACCTCCATCAGTGAGG - Intergenic
1182071536 22:27467130-27467152 GCTGGAGACCCTCATGGGTTGGG - Intergenic
1184094165 22:42307599-42307621 GATGGTGACTCACAGAGGTGAGG + Intronic
1184725641 22:46343775-46343797 TATGGTGACCCCAATGGCAGGGG - Intronic
1184751125 22:46487517-46487539 CATGGTGAGCCCCACGGGGGAGG + Intronic
1185204913 22:49532311-49532333 GATGGGGACGCGCCTGGGTGGGG - Intronic
1185204924 22:49532348-49532370 GATGGGGACGCGCCTGGGTGGGG - Intronic
1185204935 22:49532385-49532407 GATGGGGACACGCCTGGGTGGGG - Intronic
1185414719 22:50703776-50703798 ACTGGTGACCAGCATGGGTGAGG + Intergenic
949160999 3:881791-881813 AATGGAGACCCACAAGGGTGAGG - Intergenic
953270514 3:41438497-41438519 GATAGTTATCCCCATGGGTCAGG + Intronic
954213538 3:49111644-49111666 GCTGGTGACCCCTATGGCTGAGG - Exonic
954715172 3:52523338-52523360 CATGGTAACCCCCAAGGGTGTGG + Exonic
961663145 3:128481018-128481040 CATGGTGACCGCCATGGGCTAGG - Exonic
962964851 3:140344174-140344196 GATGATGACACACATGGGAGGGG - Intronic
964707375 3:159633435-159633457 GATGGTGTGCCCTGTGGGTGGGG - Intronic
966236119 3:177703660-177703682 GATGGTGACAAACCTGGGTGTGG + Intergenic
966533846 3:181009219-181009241 GATTTTCACCCCCTTGGGTGTGG + Intergenic
966595187 3:181719554-181719576 CTTGGGGAGCCCCATGGGTGAGG - Intergenic
967421315 3:189276236-189276258 GGTGGTGGCCCCCATGGATGTGG + Intronic
968958099 4:3729118-3729140 GATGGTGACCCAGAGGGCTGTGG + Intergenic
973143004 4:46792408-46792430 GATGGTCACCCTCATTGGGGAGG - Intronic
980520476 4:133926561-133926583 CTTGGTGAACCCCATTGGTGTGG - Intergenic
981775952 4:148368038-148368060 GATGGTGGCGCCCAAGGGAGGGG - Intronic
982444749 4:155477430-155477452 GAAGATGACCCCCATAGGAGAGG - Intergenic
983624762 4:169791306-169791328 GATGATGAACAACATGGGTGGGG - Intergenic
984933653 4:184870500-184870522 GATGCTCACCCACATTGGTGAGG - Intergenic
986807934 5:11326473-11326495 GATGGTGTGTCCCAGGGGTGAGG - Intronic
993636536 5:90351479-90351501 GATGGTGCCCCCCTAGGTTGAGG - Intergenic
995491898 5:112702380-112702402 GATGCTCACCCACATTGGTGAGG - Intergenic
995922438 5:117330215-117330237 GATAGTGACCCGCATTGGTAAGG - Intergenic
999271363 5:150298107-150298129 CATGGTGACCTGCATGGATGAGG - Exonic
999776022 5:154813880-154813902 GTTGCAGCCCCCCATGGGTGAGG + Exonic
1002028068 5:176408911-176408933 AATGGTTAGCCCCAAGGGTGGGG - Intronic
1005644012 6:27824364-27824386 GACGGTCACCGCCATGGATGTGG + Exonic
1005645185 6:27831266-27831288 GACGGTCACCGCCATGGATGTGG - Exonic
1006851152 6:37099715-37099737 GATGGGCACAACCATGGGTGTGG + Intergenic
1007335851 6:41154401-41154423 GATGGGCACCTCCAGGGGTGGGG + Intergenic
1012106691 6:95170167-95170189 GTTGGTGATCCACATGGATGTGG + Intergenic
1015792884 6:136981734-136981756 GAAGGTAACCCCCGTGGATGAGG - Intergenic
1016657596 6:146539779-146539801 GATGGTGCCCACCAAGGTTGAGG + Intergenic
1018467144 6:164058306-164058328 TATGATCACCCCCATGTGTGTGG - Intergenic
1018860680 6:167708830-167708852 GATGCAGACCCACAGGGGTGGGG + Intergenic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1025171528 7:56761858-56761880 AATGGTGACCACCAAGGGTAGGG + Intergenic
1025700337 7:63813623-63813645 AATGGTGACCACCAAGGGTAGGG - Intergenic
1027231045 7:76272702-76272724 GAAGGTGACACCCTTAGGTGAGG + Intronic
1027628639 7:80575281-80575303 GCTGTTGACCCCCAAGGGTGTGG + Intronic
1029656082 7:101925430-101925452 GATAGAAACCCCCAGGGGTGAGG + Intronic
1032222939 7:130008093-130008115 GAAGGGGACGCCCATGGGTGGGG - Intergenic
1032436359 7:131904182-131904204 GATGGTGGCTGCCTTGGGTGGGG + Intergenic
1032670426 7:134077338-134077360 GATGCTTACCCACATTGGTGAGG + Intergenic
1033074542 7:138236219-138236241 GATGGTGACCACCATCTGAGTGG + Intergenic
1033865633 7:145687433-145687455 GAGGGAGACCCCCAAGTGTGTGG - Intergenic
1034246303 7:149647069-149647091 GATGGTGACAGCCAGGGGTGTGG - Intergenic
1034424932 7:151009388-151009410 GATGGTGGCCCTCCTGGGGGTGG - Exonic
1035398058 7:158547948-158547970 GTGGGTGACCCCCATGGGCAAGG - Intronic
1035684934 8:1517131-1517153 GCTGGGGACCCCCATGGCTGTGG + Intronic
1037945156 8:22985056-22985078 GATCGTGGTTCCCATGGGTGTGG + Intronic
1039469595 8:37805007-37805029 CAATGTGACCCCTATGGGTGTGG + Intronic
1039469825 8:37806466-37806488 CAATGTGACCCCTATGGGTGTGG + Intronic
1053121121 9:35548128-35548150 GGAGGTGACCCTCCTGGGTGGGG - Exonic
1056481553 9:87011773-87011795 GTTGGCGGCCCGCATGGGTGAGG - Intergenic
1062268628 9:135698966-135698988 GGTGGTGCCTCCCAGGGGTGAGG - Intronic
1062342772 9:136101064-136101086 GATGGTGACCCCCCAAGGGGTGG - Intergenic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1188495399 X:30778305-30778327 GATGTCCACCCACATGGGTGAGG - Intergenic
1190108931 X:47577541-47577563 AAGGGTGACCTCCAGGGGTGGGG + Intronic
1195613659 X:106895898-106895920 GGTGGTGACACCCACAGGTGTGG - Intronic
1199823613 X:151475790-151475812 GATGCCCACCCCCATTGGTGAGG - Intergenic
1201923023 Y:19254879-19254901 GATGGTGACCACCATTGCTGAGG + Intergenic