ID: 902451593

View in Genome Browser
Species Human (GRCh38)
Location 1:16499750-16499772
Sequence TCCTGACTGACGTGCAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902451591_902451593 2 Left 902451591 1:16499725-16499747 CCGGTCAGAGAGAATGCCTTTGT No data
Right 902451593 1:16499750-16499772 TCCTGACTGACGTGCAATCCTGG No data
902451589_902451593 22 Left 902451589 1:16499705-16499727 CCGAAGCTTCGGTGATTTGACCG No data
Right 902451593 1:16499750-16499772 TCCTGACTGACGTGCAATCCTGG No data
902451588_902451593 23 Left 902451588 1:16499704-16499726 CCCGAAGCTTCGGTGATTTGACC No data
Right 902451593 1:16499750-16499772 TCCTGACTGACGTGCAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902451593 Original CRISPR TCCTGACTGACGTGCAATCC TGG Intergenic
No off target data available for this crispr