ID: 902456908

View in Genome Browser
Species Human (GRCh38)
Location 1:16539995-16540017
Sequence AGTCACCCCCAAAAATGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902456906_902456908 8 Left 902456906 1:16539964-16539986 CCATTTATGGAAGATTTTTGGAG 0: 5
1: 0
2: 2
3: 17
4: 293
Right 902456908 1:16539995-16540017 AGTCACCCCCAAAAATGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902456908 Original CRISPR AGTCACCCCCAAAAATGTTT TGG Intergenic
No off target data available for this crispr