ID: 902458539

View in Genome Browser
Species Human (GRCh38)
Location 1:16553935-16553957
Sequence ATCCAGTGGTAGCCTGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902458539_902458544 -9 Left 902458539 1:16553935-16553957 CCTCCAACAGGCTACCACTGGAT No data
Right 902458544 1:16553949-16553971 CCACTGGATTCCTGTCCTTGGGG No data
902458539_902458545 0 Left 902458539 1:16553935-16553957 CCTCCAACAGGCTACCACTGGAT No data
Right 902458545 1:16553958-16553980 TCCTGTCCTTGGGGTCTCTGTGG No data
902458539_902458547 4 Left 902458539 1:16553935-16553957 CCTCCAACAGGCTACCACTGGAT No data
Right 902458547 1:16553962-16553984 GTCCTTGGGGTCTCTGTGGATGG No data
902458539_902458542 -10 Left 902458539 1:16553935-16553957 CCTCCAACAGGCTACCACTGGAT No data
Right 902458542 1:16553948-16553970 ACCACTGGATTCCTGTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902458539 Original CRISPR ATCCAGTGGTAGCCTGTTGG AGG (reversed) Intergenic
No off target data available for this crispr