ID: 902461629

View in Genome Browser
Species Human (GRCh38)
Location 1:16581807-16581829
Sequence CAGGACACCAAACCTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 2, 1: 12, 2: 13, 3: 15, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902461629_902461631 15 Left 902461629 1:16581807-16581829 CCAGGAACAGGTTTGGTGTCCTG 0: 2
1: 12
2: 13
3: 15
4: 154
Right 902461631 1:16581845-16581867 CAAACCTCATTCTTTCTCTTAGG 0: 13
1: 2
2: 3
3: 33
4: 314
902461629_902461633 20 Left 902461629 1:16581807-16581829 CCAGGAACAGGTTTGGTGTCCTG 0: 2
1: 12
2: 13
3: 15
4: 154
Right 902461633 1:16581850-16581872 CTCATTCTTTCTCTTAGGAGAGG 0: 13
1: 4
2: 4
3: 32
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902461629 Original CRISPR CAGGACACCAAACCTGTTCC TGG (reversed) Intronic
900511639 1:3063614-3063636 CGGGTCACCAAGCCAGTTCCCGG - Intergenic
902460860 1:16575544-16575566 CAGGACACCAAGCCTGTGCCTGG - Intronic
902461629 1:16581807-16581829 CAGGACACCAAACCTGTTCCTGG - Intronic
902462410 1:16588112-16588134 CAGGACACCAAGCCTGTTCCTGG - Intronic
902962015 1:19970481-19970503 CAGCACTCCAAAGCTGTTACCGG - Intergenic
903159151 1:21472507-21472529 CAGGACACCAAGCCCGTGCCTGG + Intronic
903249665 1:22043565-22043587 CAGGACTCCAGCCGTGTTCCTGG - Intergenic
903282336 1:22257198-22257220 CTGGACTCCTACCCTGTTCCAGG + Intergenic
903831503 1:26178031-26178053 CAGAGCACCTAACATGTTCCAGG + Intronic
903908133 1:26700938-26700960 CAAGAAGCCAAACCTGGTCCTGG - Intronic
904242581 1:29158231-29158253 CTTGACACCAAACCTCTTTCAGG + Intronic
904300337 1:29549872-29549894 CCAGACACCAACCCTGTGCCAGG - Intergenic
904457898 1:30658243-30658265 CCGCACACCAACCCTGTGCCAGG + Intergenic
907172364 1:52480276-52480298 CAGGACACCAGACCCGTGTCTGG - Intronic
907679926 1:56553503-56553525 CATGACACCACACCAGGTCCTGG + Intronic
907715614 1:56923372-56923394 ACGGACACCTAACCTATTCCCGG - Intergenic
908107539 1:60860817-60860839 CAGGGCACCAAACGTGTTAGGGG + Intergenic
909556026 1:76955232-76955254 CAGGCCTCCAAACCTCTGCCTGG - Intronic
913543093 1:119840645-119840667 CAGGACACCAAGCCTGTGCCTGG - Intergenic
913603061 1:120440405-120440427 CAGGACACCAAGCCTGTTCCTGG + Intergenic
913603809 1:120446757-120446779 CAGGACACCAAGCCTGTTCCTGG + Intergenic
913604564 1:120453035-120453057 CAGGACACCAAGCCTGTGCCTGG + Intergenic
913640674 1:120809474-120809496 CAGGACACCAAGCCTGTTCCTGG + Intronic
913641435 1:120815748-120815770 CAGGACACCAAGCCTGTGCCTGG + Intronic
913990513 1:143607565-143607587 CAAGACACCAAGCCTGTGCCTGG - Intergenic
914083978 1:144436168-144436190 CGGGACACCAAGCCTGTGCCTGG - Intronic
914189999 1:145401446-145401468 CAGGACACCAAGCCTGTGCCTGG - Intronic
914211851 1:145587150-145587172 CAGGACACCAAGCCTGTTCCTGG - Intergenic
914277047 1:146134580-146134602 CAGGACACCAAGCCTGTGCCTGG - Intronic
914277804 1:146140871-146140893 CAGGACACCAAGCCTGTTCCTGG - Intronic
914364241 1:146964020-146964042 CAGGACACCAAGCCTGTTCCTGG + Intronic
914365010 1:146970310-146970332 CAGGACACCAAGCCTGTTCCTGG + Intronic
914365761 1:146976592-146976614 CAGGACACCAAGCCTGTTCCTGG + Intronic
914381362 1:147119344-147119366 CAGGACACCGATCCTGTGCCTGG - Intergenic
914486683 1:148116850-148116872 CAGGACACCAAGCCTGTGCCTGG - Intronic
914487441 1:148123116-148123138 CAGGACACCAAGCCTGTTCCTGG - Intronic
914538091 1:148585528-148585550 CAGGACACCAAGCCTGTGCCTGG - Intronic
914538849 1:148591819-148591841 CAGGACACCAAGCCTGTTCCTGG - Intronic
914587012 1:149071991-149072013 CAGGACACCAAGCCTGTGCCTGG - Intronic
914587785 1:149078270-149078292 CAGGACACCAAGCCTGTTCCTGG - Intronic
914627831 1:149479805-149479827 CAGGACACCAAGCCTGTGCCTGG + Intergenic
914940896 1:152022099-152022121 CAGGACACCAAGCCTGTGCCTGG + Intergenic
915344620 1:155191536-155191558 CCGGACACCAGGCCGGTTCCGGG - Intronic
915677295 1:157543568-157543590 CAGGACACCAACTCTGGCCCTGG - Intronic
919123290 1:193367132-193367154 GAGGACACCAAGCCTGTGGCTGG - Intergenic
919257362 1:195141511-195141533 CAGGACACCACAACTGCTGCTGG - Intergenic
919862629 1:201751263-201751285 CAGGACATCAATCCTTTTCCTGG - Intronic
920676397 1:208041319-208041341 GAGGACTCCAAAGCTGTGCCCGG + Intronic
921171238 1:212551692-212551714 TAGGATACCACACCTGTCCCTGG - Intergenic
921738316 1:218654112-218654134 CAGGAAAACAAACCAGTTGCAGG + Intergenic
921863476 1:220064018-220064040 CTGAACACCAAACATGTACCAGG + Intronic
922217344 1:223531106-223531128 CAAGACAACAAACCTGTCCAGGG - Intergenic
923692339 1:236206906-236206928 CAGGACCCCCATCCTGTTCCTGG + Intronic
924699623 1:246438516-246438538 CAGGACACCAACCCCCTCCCTGG + Intronic
1062858280 10:790412-790434 CCGGCCTCCAAACCTGTTTCTGG + Intergenic
1066150287 10:32609043-32609065 CAGGACACGGAACATTTTCCAGG - Intronic
1066239955 10:33523831-33523853 CAGGACACAACACCTGTCTCAGG + Intergenic
1071560809 10:86645505-86645527 CAGGACTCCAAAGGGGTTCCTGG - Intergenic
1072838563 10:98743941-98743963 CAGGGCACTAGAACTGTTCCAGG + Exonic
1074426532 10:113356410-113356432 TAGGTCACCAAACCTGTTAGAGG + Intergenic
1074546477 10:114405022-114405044 CGGGCAACCAAACCTGCTCCGGG + Intergenic
1075554027 10:123416611-123416633 CATGCCACCACACCTGTGCCTGG + Intergenic
1076450819 10:130555920-130555942 CAGGATTCCAATCCTGTTCCTGG + Intergenic
1076796111 10:132799242-132799264 CAGGACACCGCACCTGTGCCCGG + Intergenic
1080599350 11:33807397-33807419 CTGAACACCAAATGTGTTCCTGG - Intergenic
1081269368 11:41065196-41065218 CCCCTCACCAAACCTGTTCCCGG - Intronic
1084235092 11:67782622-67782644 GAGGACACCAATCTTCTTCCAGG + Intergenic
1085234764 11:75005937-75005959 CCGGACACCAAACAGGTGCCGGG + Exonic
1086442990 11:86847334-86847356 CAATACATCCAACCTGTTCCAGG - Intronic
1088841480 11:113630863-113630885 GAGGAGACCAAAACTCTTCCAGG + Intergenic
1089137285 11:116259843-116259865 TAGGACATCATACCTGCTCCAGG - Intergenic
1089182849 11:116594941-116594963 CAGGACCCCCAACCTGAGCCTGG - Intergenic
1090491240 11:127162703-127162725 CAGGACCCCAACACGGTTCCAGG - Intergenic
1091383788 12:79064-79086 CAGGAGAACATACCTGATCCTGG + Intronic
1094607383 12:31960027-31960049 CAGTACAGCAATTCTGTTCCAGG - Intronic
1096838094 12:54363940-54363962 CTGGACATCTAAACTGTTCCTGG + Exonic
1101182230 12:102231438-102231460 CAGTACAACAAAGCTGCTCCAGG - Intergenic
1102490886 12:113288903-113288925 AAGGACACCAATCCTGGCCCTGG - Intronic
1104274167 12:127309472-127309494 CAGAACAACACACCTGTGCCAGG + Intergenic
1105389344 13:19959694-19959716 AAGGACACCGAGCCTGCTCCCGG - Intronic
1109348287 13:61144395-61144417 AAGTCCACCAAACCTGATCCTGG - Intergenic
1112388756 13:98963770-98963792 CAGGACACCAGTACTGTTGCTGG + Intronic
1113977493 13:114239848-114239870 CAGAACACAAAACCATTTCCTGG - Intronic
1114764788 14:25358568-25358590 GAGGCCACCACACCTGTTCTTGG - Intergenic
1116054274 14:39843828-39843850 CTGGACCCCAGACATGTTCCAGG - Intergenic
1119685347 14:76626603-76626625 CAGGAGACAAAACGAGTTCCGGG - Intergenic
1123948493 15:25250363-25250385 CAGGGCAACCAACCTGCTCCTGG - Intergenic
1124100562 15:26689159-26689181 CAGGAGACCAAGACTGTCCCAGG - Intronic
1124697571 15:31878109-31878131 CATGACCCCAAAAATGTTCCTGG - Intergenic
1126878502 15:53069966-53069988 CAGGACTCCAAAGCAGTGCCAGG - Intergenic
1127652592 15:61023636-61023658 TAAGACAGCAAACCTGTTGCTGG + Intronic
1128317257 15:66668904-66668926 CAGGAGGCCAGACTTGTTCCAGG + Intronic
1128392108 15:67189358-67189380 CAAGACAGCAACACTGTTCCTGG + Intronic
1128543280 15:68551443-68551465 CAGCTCACCACAACTGTTCCCGG + Intergenic
1130956692 15:88631856-88631878 CCGGAAGCCAAACCTGTGCCTGG - Exonic
1131981445 15:97998616-97998638 CAAGCCTCCCAACCTGTTCCAGG - Intergenic
1132786943 16:1662193-1662215 TAAGACACCAAAGATGTTCCAGG - Intronic
1132908626 16:2297289-2297311 CAGGACACCGACCCTGTCGCGGG + Intronic
1132958961 16:2611796-2611818 CAGGGCACCCAACCTGTGGCAGG - Intergenic
1132972020 16:2693771-2693793 CAGGGCACCCAACCTGTGGCAGG - Intronic
1135148877 16:19988039-19988061 CAGGACCCCTAATATGTTCCTGG - Intergenic
1136520414 16:30792086-30792108 CAGGACACCCAGACTCTTCCTGG - Intergenic
1138291678 16:55853498-55853520 CATGAAACCAGCCCTGTTCCTGG + Intronic
1141152638 16:81574740-81574762 CAGGTCACCATCCCTGTTCTCGG + Intronic
1141686973 16:85576014-85576036 CAGGATAAGAAACCTCTTCCAGG - Intergenic
1144198714 17:12919937-12919959 CTGGACACCTAACGTGTACCAGG + Intronic
1147740609 17:42669346-42669368 CAGAACACCAAACCTGGGCCAGG - Intronic
1148551727 17:48554666-48554688 CAGGACACCAAAACGGTTATCGG + Intronic
1151989086 17:77562700-77562722 ATGGACACCAAACCTGCTGCCGG + Intergenic
1152202727 17:78956477-78956499 CAGGTCCCCAAACCTTCTCCCGG - Intergenic
1152368118 17:79869200-79869222 CTGGACCCCAAACCTCTTCCTGG - Intergenic
1155187364 18:23399118-23399140 CAGGACATCAACCCTGTGCCAGG + Intronic
1156359861 18:36375437-36375459 CAGGAGACAAACCCTGGTCCTGG - Intronic
1158629501 18:59099909-59099931 CAGGAGTCCAAGCCTGTTCCAGG - Intergenic
1159937824 18:74382740-74382762 CAGCACACCATGCCTGCTCCAGG + Intergenic
1161720385 19:5899004-5899026 CAGGACTCCCCACCTGCTCCTGG + Intronic
1164579230 19:29424311-29424333 CAGGACATCAAGCCCATTCCAGG - Intergenic
1165231959 19:34392949-34392971 CAGGACCTCATACCTGTGCCAGG - Intronic
1167154286 19:47728912-47728934 CAGAGCACCAATTCTGTTCCGGG - Intronic
1202677289 1_KI270711v1_random:19284-19306 CAGGACACCAAGCCTGTGCCTGG - Intergenic
1202678065 1_KI270711v1_random:25554-25576 CAGGACACCAAACCTGTTCCTGG - Intergenic
926130207 2:10298232-10298254 CAGGAAACCAAAGCCGTGCCTGG - Intergenic
932839958 2:75072756-75072778 CAGGACACCAGATGTGTGCCAGG - Intronic
935164806 2:100561275-100561297 CAGGACACCAGGCCATTTCCTGG + Intergenic
936376482 2:111945724-111945746 CAGGGCACCAAACCAGGACCTGG - Intronic
938075103 2:128327718-128327740 CAAGCCACCACCCCTGTTCCAGG - Intergenic
938992011 2:136639477-136639499 TAGCACACCTATCCTGTTCCAGG + Intergenic
941554549 2:166960426-166960448 AAGGAGATCAAACCTGATCCTGG - Intronic
946223975 2:218252500-218252522 CAGGTCACCAAACAAGTACCCGG - Intronic
947733487 2:232443421-232443443 CAGGACACCAGGGCTGTCCCAGG + Intergenic
948184798 2:236012526-236012548 AAGGAAACCAAATCTGTCCCGGG - Intronic
948612793 2:239180342-239180364 CAGGGCATCAATCCCGTTCCTGG + Intronic
1172567234 20:35940214-35940236 CAGGACCACAAACCTTTTCTAGG - Intronic
1174237111 20:49103072-49103094 CTGGACATCAAACCTGTGGCAGG - Intergenic
1174528503 20:51192516-51192538 CTGGTGACCAAACCTGTCCCTGG + Intergenic
1176360525 21:5992716-5992738 CAGCACACAAAACCTTTTCCAGG - Intergenic
1176714353 21:10337237-10337259 CGGGTCAGCAAACCAGTTCCAGG + Intergenic
1177136068 21:17306434-17306456 CAGGACACCACAGCTGCTCTTGG - Intergenic
1179762993 21:43545834-43545856 CAGCACACAAAACCTTTTCCAGG + Intronic
1181090587 22:20469744-20469766 CAGGAAAACCAACCTGTTCGGGG - Intronic
1181460607 22:23083798-23083820 CGGCACACCACACCTGTTCAAGG + Intronic
950488128 3:13284942-13284964 CAGAACACCCAATCTGTACCAGG + Intergenic
950528612 3:13539549-13539571 CAGGACACCCACTCTGTGCCAGG - Intergenic
953020919 3:39112545-39112567 CAGGACACCAAAGATGTGCTGGG + Exonic
953352344 3:42224756-42224778 CATAATACCAAACCGGTTCCAGG + Exonic
954578092 3:51687808-51687830 CATGAGACCAATCCTGTTCCAGG - Intronic
954678411 3:52327954-52327976 CTGGACAGGAAACCTGTCCCGGG + Exonic
957823161 3:85405242-85405264 CAGGCCATCAAAACTGTTCTAGG - Intronic
959465421 3:106680491-106680513 TAACACACCACACCTGTTCCAGG - Intergenic
963452469 3:145501168-145501190 CAGGTAACACAACCTGTTCCTGG - Intergenic
963516011 3:146308878-146308900 CAGGAAACCAAAAGTTTTCCTGG + Intergenic
964598264 3:158463771-158463793 CTGCACACCAAAACTGGTCCAGG + Intronic
967102857 3:186230607-186230629 CAGGACCACAAACGTGTCCCAGG + Intronic
968524190 4:1047581-1047603 TAGGACACCTCACCTGCTCCTGG + Intergenic
973168474 4:47108818-47108840 CAGGACACCAAAACAGATCATGG + Intronic
980321402 4:131282933-131282955 TAGGACACCAAACCTGCCCATGG + Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
983233384 4:165152016-165152038 CACAACAACAAACCTGGTCCTGG - Intronic
983989228 4:174097514-174097536 CAAGACTCCAAACCTGTCTCAGG + Intergenic
986694330 5:10338745-10338767 CAGGAGACCAGTCCTGTTGCTGG + Intergenic
986757727 5:10853774-10853796 CAGGCCACCCAATCTGTTGCAGG + Intergenic
993125429 5:83829581-83829603 AGAGACACCAAAACTGTTCCAGG - Intergenic
995705168 5:114981240-114981262 CAGGAAACGAAACCAGTGCCAGG - Intergenic
1000768496 5:165320491-165320513 AAGAAAACCAAACCTTTTCCAGG - Intergenic
1001104093 5:168838652-168838674 CAGGACACCAACCCCGCTCTAGG + Intronic
1004953440 6:20701112-20701134 TAGGACACCAGATTTGTTCCTGG + Intronic
1007834478 6:44664100-44664122 CCCAACACCAAACCAGTTCCAGG + Intergenic
1008084096 6:47225840-47225862 CAGAACACCTACCATGTTCCAGG + Intergenic
1008807502 6:55449455-55449477 CAGCCCACCACACATGTTCCTGG - Intronic
1011849304 6:91605566-91605588 CAGGACACAAAAGCTGTACAGGG - Intergenic
1012432216 6:99175976-99175998 AAGGACACTAATCCTGTTCATGG + Intergenic
1015814646 6:137195596-137195618 CTGAACAACAAAACTGTTCCAGG + Intergenic
1017300119 6:152847147-152847169 AAGGTCACCAAACCTGGTCTGGG - Intergenic
1018817910 6:167349672-167349694 CAGGAGAAAAAACATGTTCCGGG + Intronic
1021183972 7:17541386-17541408 CAATACAACAAACCTATTCCTGG + Intergenic
1032076703 7:128839422-128839444 CAGGACACGACACATATTCCAGG - Intronic
1033242629 7:139692941-139692963 CAAGTCACCAAACCTGTTGGAGG - Intronic
1034012278 7:147542688-147542710 CATGACACCAAACCTGTTCAAGG - Intronic
1036469053 8:9033820-9033842 TAGGACAACCTACCTGTTCCTGG - Intronic
1038430051 8:27492892-27492914 CAGGACACCCCACCTGCTACTGG + Intronic
1045651044 8:104341910-104341932 CAGGATACAATACCTGTTTCTGG - Intronic
1047014655 8:120710745-120710767 CCAGACACCAAACCTATTGCTGG + Intronic
1048538832 8:135323934-135323956 CAGGAGACCAGAGCTGTCCCTGG + Intergenic
1048704696 8:137140147-137140169 CAGGAAAACAAATCTGTTCTAGG - Intergenic
1049163071 8:141110139-141110161 CAGGACAACAAAGCTGATGCGGG - Intergenic
1056936712 9:90920111-90920133 CAGGGCACCCAGACTGTTCCAGG - Intergenic
1057857739 9:98614968-98614990 CAGGACAGAGAAGCTGTTCCAGG - Intronic
1059781483 9:117532878-117532900 TAGGACACCTAACCTTTTCTGGG + Intergenic
1060542155 9:124438337-124438359 CAGGTCAGCCAAGCTGTTCCGGG + Intergenic
1188762860 X:34053995-34054017 CTGGGCACCAAAGCTGTTGCAGG - Intergenic
1192450963 X:71244606-71244628 AAGGTCATCAAAGCTGTTCCTGG - Intronic
1193888605 X:87014893-87014915 CGGAACACCAAACATGTCCCTGG + Intergenic
1197032633 X:121836103-121836125 CAGGAAACAAACTCTGTTCCAGG - Intergenic
1199866417 X:151853844-151853866 CTGGACACCATCCCTCTTCCAGG - Intergenic
1201469034 Y:14314272-14314294 CAGGACACCAAAACTGCTGTTGG - Intergenic
1201911816 Y:19140264-19140286 CAGGACACCACAACTGTTGTTGG - Intergenic