ID: 902464568

View in Genome Browser
Species Human (GRCh38)
Location 1:16608070-16608092
Sequence CTAAGGCTCCTACACTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 2, 1: 0, 2: 1, 3: 11, 4: 99}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902464568_902464577 0 Left 902464568 1:16608070-16608092 CCAGGACAGTGTAGGAGCCTTAG 0: 2
1: 0
2: 1
3: 11
4: 99
Right 902464577 1:16608093-16608115 CCTGGGGGATGCAGGTGGACAGG 0: 3
1: 5
2: 2
3: 35
4: 434
902464568_902464582 7 Left 902464568 1:16608070-16608092 CCAGGACAGTGTAGGAGCCTTAG 0: 2
1: 0
2: 1
3: 11
4: 99
Right 902464582 1:16608100-16608122 GATGCAGGTGGACAGGGAGGGGG 0: 3
1: 6
2: 7
3: 104
4: 1200
902464568_902464581 6 Left 902464568 1:16608070-16608092 CCAGGACAGTGTAGGAGCCTTAG 0: 2
1: 0
2: 1
3: 11
4: 99
Right 902464581 1:16608099-16608121 GGATGCAGGTGGACAGGGAGGGG 0: 3
1: 6
2: 5
3: 61
4: 723
902464568_902464579 4 Left 902464568 1:16608070-16608092 CCAGGACAGTGTAGGAGCCTTAG 0: 2
1: 0
2: 1
3: 11
4: 99
Right 902464579 1:16608097-16608119 GGGGATGCAGGTGGACAGGGAGG 0: 3
1: 6
2: 6
3: 90
4: 968
902464568_902464578 1 Left 902464568 1:16608070-16608092 CCAGGACAGTGTAGGAGCCTTAG 0: 2
1: 0
2: 1
3: 11
4: 99
Right 902464578 1:16608094-16608116 CTGGGGGATGCAGGTGGACAGGG 0: 3
1: 6
2: 4
3: 58
4: 477
902464568_902464575 -5 Left 902464568 1:16608070-16608092 CCAGGACAGTGTAGGAGCCTTAG 0: 2
1: 0
2: 1
3: 11
4: 99
Right 902464575 1:16608088-16608110 CTTAGCCTGGGGGATGCAGGTGG 0: 4
1: 5
2: 1
3: 25
4: 374
902464568_902464580 5 Left 902464568 1:16608070-16608092 CCAGGACAGTGTAGGAGCCTTAG 0: 2
1: 0
2: 1
3: 11
4: 99
Right 902464580 1:16608098-16608120 GGGATGCAGGTGGACAGGGAGGG 0: 3
1: 6
2: 10
3: 81
4: 870
902464568_902464573 -8 Left 902464568 1:16608070-16608092 CCAGGACAGTGTAGGAGCCTTAG 0: 2
1: 0
2: 1
3: 11
4: 99
Right 902464573 1:16608085-16608107 AGCCTTAGCCTGGGGGATGCAGG 0: 4
1: 5
2: 3
3: 23
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902464568 Original CRISPR CTAAGGCTCCTACACTGTCC TGG (reversed) Intronic
900342900 1:2197139-2197161 CTCAGGCCCCTGCCCTGTCCTGG + Intronic
900399724 1:2467967-2467989 CAAAGGGTCCAACACAGTCCAGG + Intronic
900797087 1:4714536-4714558 CTAAGCCTACAACGCTGTCCCGG - Intronic
900934254 1:5755391-5755413 CACTGGCTCCTTCACTGTCCTGG + Intergenic
901696711 1:11012990-11013012 CGAAGGCTCCGGCACTGTCCGGG - Intronic
902173739 1:14633758-14633780 CTGAGGCTCCTACAGTGCCTTGG + Intronic
902464568 1:16608070-16608092 CTAAGGCTCCTACACTGTCCTGG - Intronic
903156239 1:21445635-21445657 CTAAGGCTCCTACACTGTCCTGG + Intronic
904424022 1:30412113-30412135 CTCAGACTCCTCCACCGTCCAGG - Intergenic
905893250 1:41530029-41530051 CTCACGCTCATACACTCTCCTGG + Intronic
907516093 1:54994350-54994372 TCCAGGCTCCTAGACTGTCCTGG - Intergenic
908478918 1:64517768-64517790 GTAAAGGTGCTACACTGTCCAGG - Intronic
908607342 1:65812900-65812922 CTAAGGGTCCTAGACAGCCCTGG + Intronic
910723131 1:90309648-90309670 CTAAGCATCCTACAATGTGCAGG - Intergenic
911549796 1:99264736-99264758 CTGCGCCTCCAACACTGTCCAGG - Intronic
913993326 1:143635071-143635093 CTAAGGCCCCTGCTCTGTCCTGG - Intergenic
914513083 1:148351824-148351846 TTAAAGCTGCTGCACTGTCCTGG - Intergenic
919659029 1:200225208-200225230 CAAAGGATTCTACACTGTCCAGG + Intergenic
922769679 1:228175210-228175232 CAAAGGCTGCTACATTGGCCAGG + Exonic
923454423 1:234150998-234151020 CTGAGCCTCTTACACTGACCTGG - Intronic
1063525662 10:6782515-6782537 CTAAGTATCCTACAATGTGCAGG - Intergenic
1072481722 10:95815556-95815578 CTGAGGCTCATACAGTGTCTGGG - Intronic
1076525894 10:131112276-131112298 CTCTGACTCCCACACTGTCCTGG + Intronic
1077590579 11:3487885-3487907 CTAAGCATCCTACAATGCCCCGG + Intergenic
1077651587 11:3978002-3978024 CTCTGCCTCCTACAGTGTCCTGG - Intronic
1077807705 11:5605915-5605937 CTAAGCATCCTACAATGTACAGG - Intronic
1078654892 11:13229446-13229468 CTCGGACTCCAACACTGTCCAGG + Intergenic
1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG + Intergenic
1086177163 11:83904941-83904963 GTAAGCCTCCTACACTGTACTGG - Intronic
1091442355 12:521310-521332 CTAAGTCACTTAGACTGTCCTGG + Intronic
1100213266 12:92420402-92420424 CTAAGCTTCCTACATTCTCCTGG - Exonic
1104720026 12:131040069-131040091 CTCAGGCTCCTACAGGGGCCGGG - Intronic
1106565529 13:30881467-30881489 CTCAGGCTCTGACACTGTCATGG + Intergenic
1110303420 13:73956440-73956462 CTAAGCATCCTACAATGTACAGG - Intronic
1112764736 13:102728803-102728825 GAAAGCCTCCTACAGTGTCCAGG + Intergenic
1116881725 14:50177074-50177096 TTAAGTCTGCTACACAGTCCAGG + Intronic
1126896146 15:53258724-53258746 CTGAGGCTCCAACCCTGTGCTGG - Intergenic
1127903862 15:63361510-63361532 CTAAGGATCCTGCAATGTGCAGG + Intronic
1132291779 15:100708944-100708966 CTCTGGCTACTACGCTGTCCTGG - Intergenic
1133756206 16:8764464-8764486 CTAAGACACCTACACGTTCCAGG - Intronic
1136170150 16:28484249-28484271 CTAAGGCTCCTACGCTGTGCGGG + Intronic
1138391252 16:56671288-56671310 AAAAGGCACCTGCACTGTCCTGG + Intronic
1139511104 16:67429066-67429088 AGCAGGGTCCTACACTGTCCTGG - Intergenic
1146012665 17:29208156-29208178 CTAACCCTCCTACAATGCCCAGG - Intergenic
1148994768 17:51700176-51700198 CTAAGACTACTTCACTGACCGGG - Intronic
1151433801 17:74081853-74081875 CTAAGTATCCTACAATGTGCAGG + Intergenic
1152464543 17:80458366-80458388 CTAAGGACGCTCCACTGTCCTGG + Intergenic
1161523061 19:4736622-4736644 CTCAGCATCCTGCACTGTCCAGG + Intergenic
1162939119 19:13997499-13997521 CTCTGGCTCCTTCACTGCCCAGG + Intronic
927252136 2:21005872-21005894 CTAAGGATCCTGCAATGTCAAGG + Exonic
934661810 2:96147055-96147077 CTAAGGCTACTCCACTGTCTGGG + Intergenic
934687703 2:96333837-96333859 CTAAGCGTCCTACAAGGTCCTGG - Intergenic
937225454 2:120366299-120366321 CAGAGGCTCCTGCAATGTCCAGG + Intergenic
938645698 2:133327937-133327959 CTAAGCATCCTACAATGCCCAGG + Intronic
939175667 2:138744916-138744938 CTAAGAGTCCTGCACTCTCCAGG - Intronic
940848248 2:158663687-158663709 CTGTGGCTTCTACACTGTGCTGG - Intronic
943710387 2:191087526-191087548 CTCAGACTCTTACTCTGTCCTGG - Intronic
945182992 2:207110978-207111000 CTAAGTATCCTACAATGCCCAGG - Intronic
946352258 2:219162797-219162819 CTAAACATCCTACACTGTACAGG - Intronic
948199543 2:236119858-236119880 CTCAGGCTCATACACTGCCTTGG - Intronic
1182511935 22:30826125-30826147 ATGAGGCTCCTTCTCTGTCCTGG - Intronic
1184732247 22:46377434-46377456 CTGAGGCTCCTTCAATGCCCTGG + Intronic
949769309 3:7561547-7561569 CTAAGGGTACTACGATGTCCTGG - Intronic
953785380 3:45907232-45907254 CTAAGCCTCCTCCCCTGCCCAGG + Intronic
955026336 3:55171279-55171301 ATATGGCCCCTGCACTGTCCTGG - Intergenic
955408655 3:58642017-58642039 CTGAGGCTCCTACAGTCTTCTGG + Intronic
955410370 3:58651736-58651758 CTGAGCCTCCTACACTGACTTGG + Intronic
958641175 3:96807215-96807237 CTATGTCTGCTACACTGTCCTGG - Intergenic
966882170 3:184356694-184356716 CTGAGGCTCAAACACTCTCCAGG + Intronic
969748358 4:9091678-9091700 CTAAGCATCCTACAATGCCCCGG - Intergenic
983937027 4:173509340-173509362 CTGAGCCTCCCACTCTGTCCTGG + Intergenic
985083045 4:186285963-186285985 CTAAGGCTGACACACTTTCCTGG + Intronic
988487952 5:31682355-31682377 CTAAGGCACCGACATTCTCCCGG - Intronic
989563468 5:42877178-42877200 GTAAGCCCCCTGCACTGTCCCGG + Intronic
992620464 5:78587472-78587494 CTAAGTCTCCCACTTTGTCCAGG - Intronic
995283605 5:110362157-110362179 CTAAGGCTCTTCCACTTACCTGG - Intronic
998682167 5:144480736-144480758 CTAAAGATCCTACAGTGTACTGG + Exonic
1002546019 5:179945842-179945864 CTCAGGCTCCCACACTCTTCGGG - Intronic
1002618935 5:180472814-180472836 CTAAGCCTCCTGCAATGCCCAGG + Intergenic
1003748867 6:9033260-9033282 CTAAGAATCCTACAGTGGCCGGG - Intergenic
1005946170 6:30597555-30597577 CTGAGGCTGCTACACTGCCCTGG - Intergenic
1007448878 6:41927974-41927996 CTAAACCTCCTACACTGCACAGG - Intronic
1007764227 6:44151584-44151606 CTAAGGCTGCTAGAATGTTCAGG - Intronic
1009569768 6:65369701-65369723 CTAAGGATCCTACAGTGCACAGG - Intronic
1018123530 6:160659798-160659820 ATAAGGCAGCTACACTGTGCTGG + Intronic
1018146857 6:160899901-160899923 ATAAGGCAGCTACACTGTTCTGG - Intergenic
1020122581 7:5513458-5513480 CCAAGACTCCTACCCTGTCTCGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1029606272 7:101601246-101601268 CTCAGGCTCCTGCACCGTCTGGG - Intergenic
1029737712 7:102473805-102473827 CTTTGGCTGCTCCACTGTCCTGG - Intronic
1031095032 7:117406844-117406866 CTAAGATTCCTGCATTGTCCAGG + Intronic
1034475243 7:151277799-151277821 CTAGGGCTCCTTCACTCTGCAGG - Intronic
1036371421 8:8165972-8165994 CTAAGCATCCTACAATGCCCCGG - Intergenic
1036879482 8:12499672-12499694 CTAAGCATCCTACAATGCCCCGG + Intergenic
1040087619 8:43362578-43362600 CTAAGGCTCCTACAATGTTATGG + Intergenic
1043457488 8:80426929-80426951 GTAATGCTCCTGCATTGTCCAGG - Intergenic
1043918175 8:85948940-85948962 CTAAGGCTCCACCATTGGCCTGG + Intergenic
1045035006 8:98170054-98170076 TAAAGTCTCCTACAATGTCCCGG - Intergenic
1049332251 8:142060839-142060861 CTAAGACTCCTTCGCTGCCCTGG + Intergenic
1049839626 8:144762752-144762774 CTGTGGCTCCTCCACTGACCAGG - Intergenic
1050138792 9:2496000-2496022 CTGCAGCTCCTACACTCTCCAGG - Intergenic
1053191886 9:36078482-36078504 CTAAGCATCCTACACTGCACAGG - Intronic
1056924837 9:90825647-90825669 CTAAAAATCCTCCACTGTCCAGG - Intronic
1060968259 9:127723596-127723618 CTAAGTCTCCTCCACTGAGCTGG - Intronic
1061340446 9:129976241-129976263 CTAAGCCTCCTACAATATACAGG - Intronic
1186617568 X:11205293-11205315 CTAAGCATCCTACACTGTACAGG - Intronic
1187079684 X:15973585-15973607 CTAAGCCTCCTACAATGTACAGG + Intergenic
1189636248 X:43013475-43013497 CTTAGTATCCTACTCTGTCCAGG - Intergenic
1195075630 X:101325141-101325163 TTATAACTCCTACACTGTCCAGG - Intergenic
1195973385 X:110498424-110498446 CTAGGTATCCTGCACTGTCCTGG - Intergenic
1198408989 X:136346807-136346829 CTGAGCCTTCTACACTGGCCAGG + Exonic
1201309835 Y:12586986-12587008 CTAAGCCTCCTACAATGTACAGG + Intergenic
1201493512 Y:14568273-14568295 CTACAGCTCCTACTCTGGCCAGG - Intronic