ID: 902465291

View in Genome Browser
Species Human (GRCh38)
Location 1:16613609-16613631
Sequence GCCCCGCCGCGCCTGCGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 2, 1: 4, 2: 6, 3: 26, 4: 245}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902465291_902465304 29 Left 902465291 1:16613609-16613631 CCAAGGCGCAGGCGCGGCGGGGC 0: 2
1: 4
2: 6
3: 26
4: 245
Right 902465304 1:16613661-16613683 CAACGGGTTCGAGCAGGTTAGGG 0: 1
1: 2
2: 0
3: 2
4: 15
902465291_902465299 12 Left 902465291 1:16613609-16613631 CCAAGGCGCAGGCGCGGCGGGGC 0: 2
1: 4
2: 6
3: 26
4: 245
Right 902465299 1:16613644-16613666 CGGCGGCCTCTTCTGCACAACGG 0: 1
1: 0
2: 0
3: 10
4: 111
902465291_902465303 28 Left 902465291 1:16613609-16613631 CCAAGGCGCAGGCGCGGCGGGGC 0: 2
1: 4
2: 6
3: 26
4: 245
Right 902465303 1:16613660-16613682 ACAACGGGTTCGAGCAGGTTAGG 0: 1
1: 2
2: 0
3: 2
4: 24
902465291_902465300 13 Left 902465291 1:16613609-16613631 CCAAGGCGCAGGCGCGGCGGGGC 0: 2
1: 4
2: 6
3: 26
4: 245
Right 902465300 1:16613645-16613667 GGCGGCCTCTTCTGCACAACGGG 0: 1
1: 1
2: 0
3: 9
4: 105
902465291_902465295 -5 Left 902465291 1:16613609-16613631 CCAAGGCGCAGGCGCGGCGGGGC 0: 2
1: 4
2: 6
3: 26
4: 245
Right 902465295 1:16613627-16613649 GGGGCCTTAAAGGGACCCGGCGG 0: 1
1: 1
2: 1
3: 10
4: 101
902465291_902465305 30 Left 902465291 1:16613609-16613631 CCAAGGCGCAGGCGCGGCGGGGC 0: 2
1: 4
2: 6
3: 26
4: 245
Right 902465305 1:16613662-16613684 AACGGGTTCGAGCAGGTTAGGGG 0: 1
1: 2
2: 1
3: 1
4: 41
902465291_902465302 23 Left 902465291 1:16613609-16613631 CCAAGGCGCAGGCGCGGCGGGGC 0: 2
1: 4
2: 6
3: 26
4: 245
Right 902465302 1:16613655-16613677 TCTGCACAACGGGTTCGAGCAGG 0: 1
1: 0
2: 1
3: 4
4: 24
902465291_902465294 -8 Left 902465291 1:16613609-16613631 CCAAGGCGCAGGCGCGGCGGGGC 0: 2
1: 4
2: 6
3: 26
4: 245
Right 902465294 1:16613624-16613646 GGCGGGGCCTTAAAGGGACCCGG 0: 1
1: 1
2: 4
3: 13
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902465291 Original CRISPR GCCCCGCCGCGCCTGCGCCT TGG (reversed) Intergenic