ID: 902466176

View in Genome Browser
Species Human (GRCh38)
Location 1:16620112-16620134
Sequence CTCCATCTCTGAGGGTATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902466176_902466191 20 Left 902466176 1:16620112-16620134 CCCCCATACCCTCAGAGATGGAG No data
Right 902466191 1:16620155-16620177 GGACTGATAAGGGCTATGACGGG No data
902466176_902466192 21 Left 902466176 1:16620112-16620134 CCCCCATACCCTCAGAGATGGAG No data
Right 902466192 1:16620156-16620178 GACTGATAAGGGCTATGACGGGG No data
902466176_902466190 19 Left 902466176 1:16620112-16620134 CCCCCATACCCTCAGAGATGGAG No data
Right 902466190 1:16620154-16620176 GGGACTGATAAGGGCTATGACGG No data
902466176_902466189 10 Left 902466176 1:16620112-16620134 CCCCCATACCCTCAGAGATGGAG No data
Right 902466189 1:16620145-16620167 TAAATACAAGGGACTGATAAGGG No data
902466176_902466188 9 Left 902466176 1:16620112-16620134 CCCCCATACCCTCAGAGATGGAG No data
Right 902466188 1:16620144-16620166 GTAAATACAAGGGACTGATAAGG No data
902466176_902466186 -1 Left 902466176 1:16620112-16620134 CCCCCATACCCTCAGAGATGGAG No data
Right 902466186 1:16620134-16620156 GGGTGACCAGGTAAATACAAGGG No data
902466176_902466185 -2 Left 902466176 1:16620112-16620134 CCCCCATACCCTCAGAGATGGAG No data
Right 902466185 1:16620133-16620155 AGGGTGACCAGGTAAATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902466176 Original CRISPR CTCCATCTCTGAGGGTATGG GGG (reversed) Intergenic
No off target data available for this crispr