ID: 902466181

View in Genome Browser
Species Human (GRCh38)
Location 1:16620115-16620137
Sequence ACCCTCCATCTCTGAGGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902466181_902466192 18 Left 902466181 1:16620115-16620137 CCATACCCTCAGAGATGGAGGGT No data
Right 902466192 1:16620156-16620178 GACTGATAAGGGCTATGACGGGG No data
902466181_902466189 7 Left 902466181 1:16620115-16620137 CCATACCCTCAGAGATGGAGGGT No data
Right 902466189 1:16620145-16620167 TAAATACAAGGGACTGATAAGGG No data
902466181_902466185 -5 Left 902466181 1:16620115-16620137 CCATACCCTCAGAGATGGAGGGT No data
Right 902466185 1:16620133-16620155 AGGGTGACCAGGTAAATACAAGG No data
902466181_902466188 6 Left 902466181 1:16620115-16620137 CCATACCCTCAGAGATGGAGGGT No data
Right 902466188 1:16620144-16620166 GTAAATACAAGGGACTGATAAGG No data
902466181_902466190 16 Left 902466181 1:16620115-16620137 CCATACCCTCAGAGATGGAGGGT No data
Right 902466190 1:16620154-16620176 GGGACTGATAAGGGCTATGACGG No data
902466181_902466193 28 Left 902466181 1:16620115-16620137 CCATACCCTCAGAGATGGAGGGT No data
Right 902466193 1:16620166-16620188 GGCTATGACGGGGACACGCCAGG No data
902466181_902466186 -4 Left 902466181 1:16620115-16620137 CCATACCCTCAGAGATGGAGGGT No data
Right 902466186 1:16620134-16620156 GGGTGACCAGGTAAATACAAGGG No data
902466181_902466194 29 Left 902466181 1:16620115-16620137 CCATACCCTCAGAGATGGAGGGT No data
Right 902466194 1:16620167-16620189 GCTATGACGGGGACACGCCAGGG No data
902466181_902466191 17 Left 902466181 1:16620115-16620137 CCATACCCTCAGAGATGGAGGGT No data
Right 902466191 1:16620155-16620177 GGACTGATAAGGGCTATGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902466181 Original CRISPR ACCCTCCATCTCTGAGGGTA TGG (reversed) Intergenic
No off target data available for this crispr