ID: 902466188

View in Genome Browser
Species Human (GRCh38)
Location 1:16620144-16620166
Sequence GTAAATACAAGGGACTGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902466179_902466188 7 Left 902466179 1:16620114-16620136 CCCATACCCTCAGAGATGGAGGG No data
Right 902466188 1:16620144-16620166 GTAAATACAAGGGACTGATAAGG No data
902466177_902466188 8 Left 902466177 1:16620113-16620135 CCCCATACCCTCAGAGATGGAGG No data
Right 902466188 1:16620144-16620166 GTAAATACAAGGGACTGATAAGG No data
902466174_902466188 17 Left 902466174 1:16620104-16620126 CCATCTGGCCCCCATACCCTCAG No data
Right 902466188 1:16620144-16620166 GTAAATACAAGGGACTGATAAGG No data
902466182_902466188 1 Left 902466182 1:16620120-16620142 CCCTCAGAGATGGAGGGTGACCA No data
Right 902466188 1:16620144-16620166 GTAAATACAAGGGACTGATAAGG No data
902466183_902466188 0 Left 902466183 1:16620121-16620143 CCTCAGAGATGGAGGGTGACCAG No data
Right 902466188 1:16620144-16620166 GTAAATACAAGGGACTGATAAGG No data
902466181_902466188 6 Left 902466181 1:16620115-16620137 CCATACCCTCAGAGATGGAGGGT No data
Right 902466188 1:16620144-16620166 GTAAATACAAGGGACTGATAAGG No data
902466176_902466188 9 Left 902466176 1:16620112-16620134 CCCCCATACCCTCAGAGATGGAG No data
Right 902466188 1:16620144-16620166 GTAAATACAAGGGACTGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902466188 Original CRISPR GTAAATACAAGGGACTGATA AGG Intergenic
No off target data available for this crispr