ID: 902466190

View in Genome Browser
Species Human (GRCh38)
Location 1:16620154-16620176
Sequence GGGACTGATAAGGGCTATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902466187_902466190 -9 Left 902466187 1:16620140-16620162 CCAGGTAAATACAAGGGACTGAT No data
Right 902466190 1:16620154-16620176 GGGACTGATAAGGGCTATGACGG No data
902466181_902466190 16 Left 902466181 1:16620115-16620137 CCATACCCTCAGAGATGGAGGGT No data
Right 902466190 1:16620154-16620176 GGGACTGATAAGGGCTATGACGG No data
902466176_902466190 19 Left 902466176 1:16620112-16620134 CCCCCATACCCTCAGAGATGGAG No data
Right 902466190 1:16620154-16620176 GGGACTGATAAGGGCTATGACGG No data
902466177_902466190 18 Left 902466177 1:16620113-16620135 CCCCATACCCTCAGAGATGGAGG No data
Right 902466190 1:16620154-16620176 GGGACTGATAAGGGCTATGACGG No data
902466179_902466190 17 Left 902466179 1:16620114-16620136 CCCATACCCTCAGAGATGGAGGG No data
Right 902466190 1:16620154-16620176 GGGACTGATAAGGGCTATGACGG No data
902466182_902466190 11 Left 902466182 1:16620120-16620142 CCCTCAGAGATGGAGGGTGACCA No data
Right 902466190 1:16620154-16620176 GGGACTGATAAGGGCTATGACGG No data
902466174_902466190 27 Left 902466174 1:16620104-16620126 CCATCTGGCCCCCATACCCTCAG No data
Right 902466190 1:16620154-16620176 GGGACTGATAAGGGCTATGACGG No data
902466183_902466190 10 Left 902466183 1:16620121-16620143 CCTCAGAGATGGAGGGTGACCAG No data
Right 902466190 1:16620154-16620176 GGGACTGATAAGGGCTATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902466190 Original CRISPR GGGACTGATAAGGGCTATGA CGG Intergenic
No off target data available for this crispr