ID: 902466193

View in Genome Browser
Species Human (GRCh38)
Location 1:16620166-16620188
Sequence GGCTATGACGGGGACACGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902466177_902466193 30 Left 902466177 1:16620113-16620135 CCCCATACCCTCAGAGATGGAGG No data
Right 902466193 1:16620166-16620188 GGCTATGACGGGGACACGCCAGG No data
902466182_902466193 23 Left 902466182 1:16620120-16620142 CCCTCAGAGATGGAGGGTGACCA No data
Right 902466193 1:16620166-16620188 GGCTATGACGGGGACACGCCAGG No data
902466183_902466193 22 Left 902466183 1:16620121-16620143 CCTCAGAGATGGAGGGTGACCAG No data
Right 902466193 1:16620166-16620188 GGCTATGACGGGGACACGCCAGG No data
902466181_902466193 28 Left 902466181 1:16620115-16620137 CCATACCCTCAGAGATGGAGGGT No data
Right 902466193 1:16620166-16620188 GGCTATGACGGGGACACGCCAGG No data
902466187_902466193 3 Left 902466187 1:16620140-16620162 CCAGGTAAATACAAGGGACTGAT No data
Right 902466193 1:16620166-16620188 GGCTATGACGGGGACACGCCAGG No data
902466179_902466193 29 Left 902466179 1:16620114-16620136 CCCATACCCTCAGAGATGGAGGG No data
Right 902466193 1:16620166-16620188 GGCTATGACGGGGACACGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902466193 Original CRISPR GGCTATGACGGGGACACGCC AGG Intergenic
No off target data available for this crispr