ID: 902472295

View in Genome Browser
Species Human (GRCh38)
Location 1:16657279-16657301
Sequence CAGGCTCAGGCCTCTGTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902472289_902472295 -10 Left 902472289 1:16657266-16657288 CCTCCTGGGAAGGCAGGCTCAGG No data
Right 902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG No data
902472282_902472295 10 Left 902472282 1:16657246-16657268 CCCTGGGTGAGAGTCCTGGGCCT No data
Right 902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG No data
902472287_902472295 -4 Left 902472287 1:16657260-16657282 CCTGGGCCTCCTGGGAAGGCAGG No data
Right 902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG No data
902472277_902472295 27 Left 902472277 1:16657229-16657251 CCAGCTGCAGGGAAGGGCCCTGG No data
Right 902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG No data
902472283_902472295 9 Left 902472283 1:16657247-16657269 CCTGGGTGAGAGTCCTGGGCCTC No data
Right 902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902472295 Original CRISPR CAGGCTCAGGCCTCTGTAGG GGG Intergenic
No off target data available for this crispr