ID: 902472458

View in Genome Browser
Species Human (GRCh38)
Location 1:16658292-16658314
Sequence CAGCTGTCCCTCCACCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902472458_902472461 1 Left 902472458 1:16658292-16658314 CCCGGCTGGTGGAGGGACAGCTG No data
Right 902472461 1:16658316-16658338 GCCCTGCAGGCCGCTGCGTCCGG No data
902472458_902472466 12 Left 902472458 1:16658292-16658314 CCCGGCTGGTGGAGGGACAGCTG No data
Right 902472466 1:16658327-16658349 CGCTGCGTCCGGGCAGACCCCGG No data
902472458_902472463 2 Left 902472458 1:16658292-16658314 CCCGGCTGGTGGAGGGACAGCTG No data
Right 902472463 1:16658317-16658339 CCCTGCAGGCCGCTGCGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902472458 Original CRISPR CAGCTGTCCCTCCACCAGCC GGG (reversed) Intergenic
No off target data available for this crispr