ID: 902472505

View in Genome Browser
Species Human (GRCh38)
Location 1:16658448-16658470
Sequence CACCCACCGCTGCCCGGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902472505_902472512 14 Left 902472505 1:16658448-16658470 CCGGTGCCGGGCAGCGGTGGGTG No data
Right 902472512 1:16658485-16658507 CCCACAGCGCCCCCAGCCCTGGG No data
902472505_902472514 20 Left 902472505 1:16658448-16658470 CCGGTGCCGGGCAGCGGTGGGTG No data
Right 902472514 1:16658491-16658513 GCGCCCCCAGCCCTGGGACGTGG No data
902472505_902472510 13 Left 902472505 1:16658448-16658470 CCGGTGCCGGGCAGCGGTGGGTG No data
Right 902472510 1:16658484-16658506 GCCCACAGCGCCCCCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902472505 Original CRISPR CACCCACCGCTGCCCGGCAC CGG (reversed) Intergenic
No off target data available for this crispr