ID: 902472512

View in Genome Browser
Species Human (GRCh38)
Location 1:16658485-16658507
Sequence CCCACAGCGCCCCCAGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902472502_902472512 17 Left 902472502 1:16658445-16658467 CCTCCGGTGCCGGGCAGCGGTGG No data
Right 902472512 1:16658485-16658507 CCCACAGCGCCCCCAGCCCTGGG No data
902472505_902472512 14 Left 902472505 1:16658448-16658470 CCGGTGCCGGGCAGCGGTGGGTG No data
Right 902472512 1:16658485-16658507 CCCACAGCGCCCCCAGCCCTGGG No data
902472507_902472512 8 Left 902472507 1:16658454-16658476 CCGGGCAGCGGTGGGTGCGGCAC No data
Right 902472512 1:16658485-16658507 CCCACAGCGCCCCCAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902472512 Original CRISPR CCCACAGCGCCCCCAGCCCT GGG Intergenic
No off target data available for this crispr