ID: 902472514

View in Genome Browser
Species Human (GRCh38)
Location 1:16658491-16658513
Sequence GCGCCCCCAGCCCTGGGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902472507_902472514 14 Left 902472507 1:16658454-16658476 CCGGGCAGCGGTGGGTGCGGCAC No data
Right 902472514 1:16658491-16658513 GCGCCCCCAGCCCTGGGACGTGG No data
902472509_902472514 -9 Left 902472509 1:16658477-16658499 CCACAGTGCCCACAGCGCCCCCA No data
Right 902472514 1:16658491-16658513 GCGCCCCCAGCCCTGGGACGTGG No data
902472505_902472514 20 Left 902472505 1:16658448-16658470 CCGGTGCCGGGCAGCGGTGGGTG No data
Right 902472514 1:16658491-16658513 GCGCCCCCAGCCCTGGGACGTGG No data
902472502_902472514 23 Left 902472502 1:16658445-16658467 CCTCCGGTGCCGGGCAGCGGTGG No data
Right 902472514 1:16658491-16658513 GCGCCCCCAGCCCTGGGACGTGG No data
902472508_902472514 -8 Left 902472508 1:16658476-16658498 CCCACAGTGCCCACAGCGCCCCC No data
Right 902472514 1:16658491-16658513 GCGCCCCCAGCCCTGGGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902472514 Original CRISPR GCGCCCCCAGCCCTGGGACG TGG Intergenic
No off target data available for this crispr