ID: 902478456

View in Genome Browser
Species Human (GRCh38)
Location 1:16700005-16700027
Sequence CGTCGCAGGAGCTCGGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 2, 1: 0, 2: 1, 3: 5, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902478449_902478456 -6 Left 902478449 1:16699988-16700010 CCGTAGCCCGTCGTGGCCGTCGC 0: 2
1: 0
2: 1
3: 3
4: 24
Right 902478456 1:16700005-16700027 CGTCGCAGGAGCTCGGCTGCGGG 0: 2
1: 0
2: 1
3: 5
4: 85
902478448_902478456 -3 Left 902478448 1:16699985-16700007 CCTCCGTAGCCCGTCGTGGCCGT 0: 2
1: 1
2: 0
3: 4
4: 12
Right 902478456 1:16700005-16700027 CGTCGCAGGAGCTCGGCTGCGGG 0: 2
1: 0
2: 1
3: 5
4: 85
902478446_902478456 1 Left 902478446 1:16699981-16700003 CCTGCCTCCGTAGCCCGTCGTGG 0: 2
1: 1
2: 0
3: 50
4: 48
Right 902478456 1:16700005-16700027 CGTCGCAGGAGCTCGGCTGCGGG 0: 2
1: 0
2: 1
3: 5
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902478456 Original CRISPR CGTCGCAGGAGCTCGGCTGC GGG Intergenic
900419547 1:2549764-2549786 TGGAGCAGGAGCTTGGCTGCAGG + Intergenic
900425685 1:2577622-2577644 TGGAGCAGGAGCTTGGCTGCAGG - Intergenic
900627069 1:3613219-3613241 CTTCCCGGGATCTCGGCTGCAGG + Intergenic
901055939 1:6448634-6448656 CGTCACAGGAGCTCAGCTGCGGG - Exonic
901225211 1:7609267-7609289 CATGGCAGGTGCCCGGCTGCTGG + Intronic
902478456 1:16700005-16700027 CGTCGCAGGAGCTCGGCTGCGGG + Intergenic
903867945 1:26411958-26411980 CGTTGGAGGAGCTGGGCTCCCGG - Intronic
904441740 1:30536201-30536223 CATGGCAGGAGGTCTGCTGCAGG - Intergenic
908028998 1:59980244-59980266 CCTTGCAGGAGCTCTTCTGCAGG - Intergenic
914790943 1:150876728-150876750 CGCCGCAGGGGCTGGGATGCTGG - Exonic
1076392231 10:130111440-130111462 GGTCGCAGGTGCTGAGCTGCCGG + Intergenic
1080553646 11:33396264-33396286 AGTTGCAGGAGCTTAGCTGCAGG + Intergenic
1081526087 11:43928659-43928681 GGACGCAGGAGCTGGGCAGCGGG + Intronic
1084371813 11:68750297-68750319 CGTTGCAGGCGGGCGGCTGCGGG + Exonic
1102112069 12:110372144-110372166 CCTAGCAGGTGCTGGGCTGCAGG + Intergenic
1103091923 12:118103845-118103867 CGGCAGCGGAGCTCGGCTGCAGG + Exonic
1112402225 13:99086785-99086807 CGGCGCTGGAGCTAGGCGGCCGG + Intergenic
1115648948 14:35389494-35389516 GGTTGCGGGAGGTCGGCTGCAGG + Intergenic
1122183542 14:99972100-99972122 CGTCGGAGGGGCTGGGCTGGGGG + Intronic
1122246512 14:100406984-100407006 CGGAGCAGGAGCGAGGCTGCAGG + Intronic
1124339091 15:28878376-28878398 CGTTGCGGGAGCTCGCCTGATGG - Intergenic
1124372123 15:29109961-29109983 TGCCGCAGGAGCTCGCCAGCTGG + Intronic
1124374473 15:29121529-29121551 CGTGGCTGAAGCTCGGCTCCAGG + Exonic
1125478481 15:40063626-40063648 CATCCCAGGAGCCAGGCTGCTGG - Intergenic
1132568185 16:632652-632674 CGTCGGCGCAGCTGGGCTGCCGG - Exonic
1132900465 16:2251415-2251437 CTTCGCAGGGGCCCGGCTCCCGG - Exonic
1137250533 16:46737639-46737661 CCTCGCTGGAGCTCGGCCGTGGG - Intronic
1142257016 16:89018921-89018943 CGTAGGAGGGGCTGGGCTGCAGG + Intergenic
1142286747 16:89174613-89174635 AGTCCCAGGAGCTTGGCTGCAGG + Intronic
1143374885 17:6461628-6461650 CGTCTCAGGAGGGCAGCTGCGGG - Intronic
1151802515 17:76386251-76386273 GGTCGGAGGAGCTGGGCCGCTGG + Exonic
1154325913 18:13390297-13390319 CATAGCAGGAGCACGGCTCCCGG - Intronic
1155908320 18:31478994-31479016 CGTAGCAGGAGGTGAGCTGCGGG - Intergenic
1158836328 18:61334364-61334386 CCCCGCCGGAGCTCGGCTGTGGG + Intronic
1161060776 19:2213753-2213775 TGTCCCAGGGGCTGGGCTGCAGG + Intronic
1161182271 19:2892049-2892071 AGTGGCAGGATCTCGGCTGACGG + Intergenic
1162713240 19:12611457-12611479 CGTGGGAGGAGCTAGGCTGGGGG - Intronic
1163519097 19:17781357-17781379 CGTGGCAGGAGCTGGACTGGGGG + Intronic
1167748856 19:51368132-51368154 GGTCGGTGGAGCTCGGCTCCTGG - Intronic
1202712475 1_KI270714v1_random:25836-25858 CGTCGCAGGAGCTCGGCTGCGGG + Intergenic
925188517 2:1865298-1865320 GGCCGCAGGAGCAGGGCTGCTGG - Intronic
925540741 2:4964863-4964885 GGTCGCAGGAGCCCGCCTGGTGG + Intergenic
930020704 2:47000495-47000517 CGCAGCAGGAGCTCGGAGGCTGG + Intronic
931702911 2:64923497-64923519 CGTGGCAGGAACTGAGCTGCAGG - Intergenic
933967821 2:87444467-87444489 AGGCACAGGAGCTTGGCTGCAGG - Intergenic
936325977 2:111506032-111506054 AGGCACAGGAGCTTGGCTGCAGG + Intergenic
938900938 2:135798044-135798066 CGTGACAGGAGCTTGGCTGCAGG - Exonic
948602305 2:239114304-239114326 CGAGGCAGCAGCTCTGCTGCTGG + Intronic
948805495 2:240452134-240452156 CCACGCAGGACCTGGGCTGCAGG + Intronic
1172108074 20:32528435-32528457 CGTTGCTGGCGCTCAGCTGCTGG - Intronic
1174873971 20:54208159-54208181 CGGCGCCGGATCTCGGCCGCTGG + Intronic
1178865114 21:36320458-36320480 CGGCGGAACAGCTCGGCTGCGGG + Intronic
1179490858 21:41740851-41740873 CGCCGCAGGAGCGTGGCGGCGGG + Exonic
1183028254 22:35082648-35082670 CCTCCCAGAAGCTCGGGTGCAGG + Exonic
1183598634 22:38827119-38827141 CATCGCAGGGGCACAGCTGCAGG - Intronic
1185341744 22:50294065-50294087 CGCCGCCGGAGCTTTGCTGCTGG - Intronic
951728415 3:25783862-25783884 GGACGGAGGAGCTCGGCTGGAGG + Intronic
952830238 3:37558703-37558725 CCTCCCAGGAGCTAGTCTGCTGG + Intronic
961658142 3:128454398-128454420 TGTGGCAGGAGCTTGGCAGCAGG - Intergenic
964479876 3:157129908-157129930 CCTGGCATGTGCTCGGCTGCTGG + Intergenic
966828252 3:183983675-183983697 CGTTGCAGGACCTCAGCTGGAGG - Intronic
968149736 3:196327611-196327633 AGTCGCAGCAGCTCTGCTGTGGG + Intronic
970770636 4:19607982-19608004 TGTCGCAGTAGCTCTGCTGCAGG + Intergenic
973368486 4:49226670-49226692 CGGAGCAGGAGCTGGGCTGCTGG + Intergenic
973392563 4:49568755-49568777 CGGAGCAGGAGCTGGGCTTCTGG - Intergenic
976811210 4:89103282-89103304 CAGTGCAGGAGCTCGGCTCCCGG + Intronic
984846984 4:184116397-184116419 AGTGTCAGGAGCTCGGGTGCTGG - Intronic
985608964 5:875980-876002 TGTCGCAGGGACTCTGCTGCCGG - Intronic
985704239 5:1391400-1391422 GGTCCCAGCAGCTCGGCAGCAGG - Intergenic
1002895806 6:1379482-1379504 CGTGGCAGGAGCCCGGCGGCCGG - Intergenic
1002928908 6:1620285-1620307 GGTCGCAGGAGCTGGGGAGCGGG + Intergenic
1003139031 6:3456355-3456377 CGGAGCAGCAGCTCGGGTGCGGG + Exonic
1004262176 6:14117950-14117972 CGTCGCGGGAGCCAGGCTGTAGG - Exonic
1018790176 6:167142297-167142319 AGGCTCAGGAGCTCGGCTCCTGG - Intergenic
1018978161 6:168581440-168581462 GGTGGCAGGTGCTTGGCTGCAGG - Intronic
1019060045 6:169250792-169250814 ATTCCCAGGAGCTCAGCTGCAGG - Exonic
1019917852 7:4144898-4144920 CAGCGCAGGAGCTCAGCCGCTGG + Intronic
1020383059 7:7566994-7567016 CGCCGCAGGAGCCCGGACGCGGG - Exonic
1022285972 7:28956552-28956574 CGACGGAGGGGCTGGGCTGCTGG + Exonic
1024294365 7:47830911-47830933 CCTCTCAGGAGCTCTGCAGCTGG + Intronic
1024466709 7:49719056-49719078 CATCCCAGGAGCTGGGCTGGAGG + Intergenic
1030111929 7:106034272-106034294 GGTCGCAGCAGCTGGGCAGCAGG - Intergenic
1031052006 7:116953954-116953976 CGACGCAGCAGGGCGGCTGCCGG - Exonic
1036117442 8:5973145-5973167 AGTCGCAGGAGCTCTGTGGCAGG - Intergenic
1039554799 8:38468098-38468120 GGTCGCAAGAGCTCCGCGGCCGG + Intronic
1056811090 9:89764420-89764442 CTTCTGAGAAGCTCGGCTGCAGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1060231391 9:121827858-121827880 CGCTGCAGGAGCAGGGCTGCTGG + Intronic
1061680845 9:132241805-132241827 CTTCGCAGGAGCTCGGAGGTTGG + Intronic
1062647257 9:137554763-137554785 CGTCACATGAGTTCAGCTGCGGG + Intergenic
1188609968 X:32083330-32083352 AGTGGCAGGATCTCGGCTACCGG + Intronic
1190736147 X:53256868-53256890 CGTGGCAGGAGCTGGGCCCCGGG + Intronic
1199347695 X:146761201-146761223 AGACGCAGGAGCTGGGTTGCAGG - Intergenic