ID: 902478810

View in Genome Browser
Species Human (GRCh38)
Location 1:16701211-16701233
Sequence TGCAGGAAACGCGACACCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902478797_902478810 24 Left 902478797 1:16701164-16701186 CCCTGCGGTGGCCTCAGACCCTT No data
Right 902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG No data
902478805_902478810 -3 Left 902478805 1:16701191-16701213 CCGCCCGACCTGGCTCACGTTGC No data
Right 902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG No data
902478802_902478810 5 Left 902478802 1:16701183-16701205 CCTTCACCCCGCCCGACCTGGCT No data
Right 902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG No data
902478803_902478810 -1 Left 902478803 1:16701189-16701211 CCCCGCCCGACCTGGCTCACGTT No data
Right 902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG No data
902478808_902478810 -7 Left 902478808 1:16701195-16701217 CCGACCTGGCTCACGTTGCAGGA No data
Right 902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG No data
902478806_902478810 -6 Left 902478806 1:16701194-16701216 CCCGACCTGGCTCACGTTGCAGG No data
Right 902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG No data
902478798_902478810 23 Left 902478798 1:16701165-16701187 CCTGCGGTGGCCTCAGACCCTTC No data
Right 902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG No data
902478799_902478810 13 Left 902478799 1:16701175-16701197 CCTCAGACCCTTCACCCCGCCCG No data
Right 902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG No data
902478804_902478810 -2 Left 902478804 1:16701190-16701212 CCCGCCCGACCTGGCTCACGTTG No data
Right 902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG No data
902478801_902478810 6 Left 902478801 1:16701182-16701204 CCCTTCACCCCGCCCGACCTGGC No data
Right 902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902478810 Original CRISPR TGCAGGAAACGCGACACCGC AGG Intergenic
No off target data available for this crispr