ID: 902479419

View in Genome Browser
Species Human (GRCh38)
Location 1:16703918-16703940
Sequence GAGTGTGCCCAGGAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902479419_902479430 18 Left 902479419 1:16703918-16703940 CCCTCTTCCTCCTGGGCACACTC No data
Right 902479430 1:16703959-16703981 GCCCTTGATGCTGGAGTGGCTGG No data
902479419_902479433 21 Left 902479419 1:16703918-16703940 CCCTCTTCCTCCTGGGCACACTC No data
Right 902479433 1:16703962-16703984 CTTGATGCTGGAGTGGCTGGAGG No data
902479419_902479429 14 Left 902479419 1:16703918-16703940 CCCTCTTCCTCCTGGGCACACTC No data
Right 902479429 1:16703955-16703977 GCTGGCCCTTGATGCTGGAGTGG No data
902479419_902479434 27 Left 902479419 1:16703918-16703940 CCCTCTTCCTCCTGGGCACACTC No data
Right 902479434 1:16703968-16703990 GCTGGAGTGGCTGGAGGAGCAGG No data
902479419_902479426 -4 Left 902479419 1:16703918-16703940 CCCTCTTCCTCCTGGGCACACTC No data
Right 902479426 1:16703937-16703959 ACTCACCACGTGGAGGGTGCTGG 0: 2
1: 1
2: 0
3: 13
4: 160
902479419_902479425 -10 Left 902479419 1:16703918-16703940 CCCTCTTCCTCCTGGGCACACTC No data
Right 902479425 1:16703931-16703953 GGGCACACTCACCACGTGGAGGG 0: 2
1: 1
2: 1
3: 5
4: 99
902479419_902479428 9 Left 902479419 1:16703918-16703940 CCCTCTTCCTCCTGGGCACACTC No data
Right 902479428 1:16703950-16703972 AGGGTGCTGGCCCTTGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902479419 Original CRISPR GAGTGTGCCCAGGAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr