ID: 902479425

View in Genome Browser
Species Human (GRCh38)
Location 1:16703931-16703953
Sequence GGGCACACTCACCACGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 2, 1: 1, 2: 1, 3: 5, 4: 99}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902479417_902479425 -8 Left 902479417 1:16703916-16703938 CCCCCTCTTCCTCCTGGGCACAC No data
Right 902479425 1:16703931-16703953 GGGCACACTCACCACGTGGAGGG 0: 2
1: 1
2: 1
3: 5
4: 99
902479419_902479425 -10 Left 902479419 1:16703918-16703940 CCCTCTTCCTCCTGGGCACACTC No data
Right 902479425 1:16703931-16703953 GGGCACACTCACCACGTGGAGGG 0: 2
1: 1
2: 1
3: 5
4: 99
902479418_902479425 -9 Left 902479418 1:16703917-16703939 CCCCTCTTCCTCCTGGGCACACT No data
Right 902479425 1:16703931-16703953 GGGCACACTCACCACGTGGAGGG 0: 2
1: 1
2: 1
3: 5
4: 99
902479411_902479425 23 Left 902479411 1:16703885-16703907 CCCAGCAGTCTGGCTTCAGTCTG No data
Right 902479425 1:16703931-16703953 GGGCACACTCACCACGTGGAGGG 0: 2
1: 1
2: 1
3: 5
4: 99
902479412_902479425 22 Left 902479412 1:16703886-16703908 CCAGCAGTCTGGCTTCAGTCTGC No data
Right 902479425 1:16703931-16703953 GGGCACACTCACCACGTGGAGGG 0: 2
1: 1
2: 1
3: 5
4: 99
902479416_902479425 -5 Left 902479416 1:16703913-16703935 CCTCCCCCTCTTCCTCCTGGGCA No data
Right 902479425 1:16703931-16703953 GGGCACACTCACCACGTGGAGGG 0: 2
1: 1
2: 1
3: 5
4: 99
902479415_902479425 -4 Left 902479415 1:16703912-16703934 CCCTCCCCCTCTTCCTCCTGGGC No data
Right 902479425 1:16703931-16703953 GGGCACACTCACCACGTGGAGGG 0: 2
1: 1
2: 1
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902479425 Original CRISPR GGGCACACTCACCACGTGGA GGG Intergenic
900933185 1:5749191-5749213 GAGCACAAACACCACGTGGGTGG + Intergenic
901054931 1:6444672-6444694 GGGCACACTCACCACATGGAGGG - Exonic
901508320 1:9700686-9700708 GGGCAAACTCCCCAGGTGGGAGG - Intronic
902479425 1:16703931-16703953 GGGCACACTCACCACGTGGAGGG + Intergenic
905240055 1:36575645-36575667 AGGCACACTCACCAAGGGGCTGG - Intergenic
910263224 1:85312007-85312029 GGGCACAATCAGGCCGTGGAAGG - Intergenic
910731330 1:90400407-90400429 GGGCACACTCACACCATGGAGGG - Intergenic
911838951 1:102657741-102657763 GGGAACACTCAGCATGTGAATGG + Intergenic
917081020 1:171257338-171257360 TGGCACAGTCACCACTGGGATGG - Intronic
918070470 1:181130384-181130406 GGGCACGCTCACCTTGAGGAAGG + Intergenic
918976486 1:191493336-191493358 GGGCAGACTTTCCATGTGGAAGG - Intergenic
921106693 1:211987985-211988007 GGGCACACTCACAAAGTGCCTGG + Exonic
922515952 1:226208533-226208555 GGGCACACTGACCAGATGGTAGG + Intergenic
1067718904 10:48711718-48711740 GGCCACACTCACCATGAGGGTGG - Intronic
1068989176 10:63133490-63133512 TGGGACACTCACCAGGTTGAGGG - Exonic
1070782819 10:79147398-79147420 GGGCACAACCACCATGTGTATGG + Intronic
1074079639 10:110157377-110157399 GGGCACTCACAACACGGGGAAGG + Intergenic
1074431804 10:113400875-113400897 TGGGCCACTCACCAGGTGGAGGG - Intergenic
1074511813 10:114119661-114119683 GGTCATACTGACCACGTGAATGG + Intergenic
1076637181 10:131889768-131889790 GGGCACAATGACCCCATGGACGG - Intergenic
1076687265 10:132203805-132203827 AGGCACCATCACCTCGTGGACGG - Exonic
1078094306 11:8287185-8287207 GAGGACAGTCACCACGGGGAGGG - Intergenic
1079022206 11:16918382-16918404 AGGCTCACTCACCTTGTGGAAGG + Intronic
1083759371 11:64807311-64807333 GGGACCACCCACCATGTGGAAGG + Intronic
1089653682 11:119931926-119931948 GGGCAGAGCCACCACGAGGAGGG + Intergenic
1091407892 12:220477-220499 GGGCCCACTCAGCACGGTGATGG - Intergenic
1091702752 12:2674632-2674654 GGGAGCACTCACCACCTGCAGGG - Exonic
1104332501 12:127860314-127860336 GTGAACACTCACCAGGTGGGCGG + Intergenic
1113492408 13:110702896-110702918 GAGCACACTCACCCAGTGGATGG - Intronic
1113823099 13:113229509-113229531 GAGGACACTCACCAGATGGAGGG - Exonic
1116313815 14:43360518-43360540 GGGCTCTGTCACCACGTGGCTGG - Intergenic
1122113463 14:99516589-99516611 GTGGGCACTCGCCACGTGGAGGG + Intronic
1122774574 14:104111591-104111613 GGGGGCACTCACGACGTGCAGGG - Exonic
1124236529 15:27993807-27993829 GGCCCCACACACCACGTGGGAGG + Intronic
1130064186 15:80591256-80591278 GTGCACAGTCACCAAGTGCAAGG + Intronic
1136026787 16:27473808-27473830 GGGAACACTCTCCATGTGGTGGG + Intronic
1139972121 16:70782796-70782818 GGCCACACACACCAGGTGAAAGG + Intronic
1140514468 16:75532163-75532185 GGGGAGACTCACCAGGTGGAGGG - Intronic
1140707216 16:77641892-77641914 GGGCACAGCCACCATGAGGATGG - Intergenic
1140946851 16:79776685-79776707 GAGCACACTCACCAGATGGCTGG - Intergenic
1141816093 16:86410166-86410188 GTGCGCATTCACCAAGTGGAAGG + Intergenic
1143293606 17:5853708-5853730 GACCACACTGACCACGAGGAAGG - Intronic
1144847758 17:18228915-18228937 GGGCTCAGTCCCCACCTGGATGG + Intronic
1147339492 17:39745313-39745335 GGGCACACTCACCAAGGGTGGGG - Exonic
1148115544 17:45172681-45172703 GGGCACACTGAGCATGTGCAGGG + Intergenic
1148921951 17:51044600-51044622 TTGAACACTCACCACGTGGTGGG + Intronic
1149195655 17:54116951-54116973 GGGCACCATCACCTCGGGGATGG - Intergenic
1150476088 17:65476383-65476405 TGGCACACTCACCTGGTGGCAGG - Intergenic
1151232957 17:72697803-72697825 TGATACACTCGCCACGTGGATGG + Intronic
1151269324 17:72981078-72981100 AGGCACAATCACCAAGGGGAAGG + Intronic
1152755178 17:82084222-82084244 CGACACACTCACCAGTTGGAAGG + Exonic
1155891626 18:31277593-31277615 GAGCACACCCATCACATGGAAGG - Intergenic
1156257437 18:35411141-35411163 GGGTAGAGTCACCAAGTGGAGGG + Intergenic
1163007382 19:14405594-14405616 GGCCACACTTACCAGCTGGAAGG - Intronic
1163371923 19:16905938-16905960 GGGCTCACTCAGCAAGTGGAGGG + Intronic
1166614935 19:44235177-44235199 TTCCACACTCACCACATGGATGG - Exonic
1202713464 1_KI270714v1_random:29837-29859 GGGCACACTCACCACGTGGAGGG + Intergenic
925894445 2:8460571-8460593 GGGCACACTGACGACATGGCAGG - Intergenic
933997886 2:87683312-87683334 ATGCACACTCACAAGGTGGATGG - Intergenic
934158224 2:89222939-89222961 GGGCTCACTCACCAGGTGCCAGG - Intergenic
934209040 2:89959485-89959507 GGGCTCACTCACCAGGTGCCAGG + Intergenic
936295965 2:111267554-111267576 ATGCACACTCACAAGGTGGATGG + Intergenic
943688315 2:190842749-190842771 TGGCTCACTCACCACCTGGCAGG + Intergenic
948494550 2:238338897-238338919 GGGCACACCCACCACACGGCTGG - Intronic
1169397412 20:5244937-5244959 GGGAACACTCACCAAGTGTTAGG + Intergenic
1174389936 20:50212826-50212848 TGGCAAACGCACCATGTGGACGG - Intergenic
1174479696 20:50822169-50822191 GTGCACGCTCTCCACGTGGCTGG + Intronic
1176168572 20:63686981-63687003 GGGCACACTCAGCCCCAGGAAGG + Intronic
1180076843 21:45467440-45467462 GGCCACAATCACCCCTTGGAGGG - Intronic
1180259021 21:46654023-46654045 GGGCACATTCACCTCGGGGGAGG + Intronic
953824083 3:46234908-46234930 AGGTCCACTCACCAGGTGGAGGG + Intronic
954116540 3:48469716-48469738 GGGCACGCTTACGACGTGGTCGG + Exonic
958170475 3:89933369-89933391 GTTCACACTCACCATTTGGAGGG + Intergenic
959411956 3:106035542-106035564 AGGCACACTCATCCCCTGGAAGG - Intergenic
968222461 3:196948765-196948787 GGGCACACACACCAAGGGGTGGG - Intronic
970317722 4:14845401-14845423 GTGCACCCTCCCCACGTGGAAGG + Intergenic
972645766 4:40966634-40966656 GGGCACTGTCACAACCTGGATGG + Intronic
977716508 4:100189881-100189903 GGGGACACTCACCACTTAGCAGG + Exonic
981099105 4:140811181-140811203 AGGCACACTCACATCGTGAAGGG + Intergenic
983955922 4:173698722-173698744 GGGCTCTCTCACCAGGAGGAGGG - Intergenic
991447228 5:66713231-66713253 GGGCACACAGCCCACCTGGAAGG + Intronic
991486772 5:67145300-67145322 GGGCACACTCTTCAGGAGGAAGG - Exonic
992497106 5:77304981-77305003 TGGAACACTTACCTCGTGGAAGG - Intronic
997193898 5:131964933-131964955 GGGCACACTCACCTCGGGAGAGG - Intronic
1001213399 5:169832400-169832422 GGGGACACTCACCCAGTGGGTGG + Intronic
1002951368 6:1815512-1815534 GGCCATATTCACCAAGTGGAAGG - Intronic
1012545821 6:100418489-100418511 GCCCACCCTCACCACATGGAAGG + Intronic
1013343222 6:109235859-109235881 GGGCACAGACACGAGGTGGAAGG + Intergenic
1017657675 6:156645599-156645621 GGGCAGTCTCCCCAGGTGGATGG + Intergenic
1018056590 6:160057241-160057263 GGGTGCACTCAACAAGTGGAGGG - Intronic
1019383688 7:741455-741477 GCGGTCACTCACCATGTGGAGGG - Exonic
1022361274 7:29660768-29660790 GGGCACGATGACCACGTGAAGGG + Intergenic
1022700530 7:32754928-32754950 GGGCACGATGACCACGTGAAGGG - Intergenic
1026518205 7:71091178-71091200 AGGCGCACTCAGCATGTGGATGG - Intergenic
1027234128 7:76287626-76287648 GGGGACACTCACAACATGGTGGG + Intergenic
1030062476 7:105633932-105633954 GTGCACACACACCAGGAGGAGGG + Intronic
1031111594 7:117617296-117617318 GGGCATAAGCACCAGGTGGAAGG - Intronic
1033264501 7:139873140-139873162 GGGTACACACACCAGGTGGGTGG + Intronic
1034533055 7:151708618-151708640 GGATACACTGTCCACGTGGAGGG + Intronic
1034735017 7:153420851-153420873 GGGCAAACTCAACATCTGGAAGG - Intergenic
1037909552 8:22735737-22735759 GGGGACACTGCCCACGTGGCAGG + Intronic
1042672037 8:71275091-71275113 GGGCTCACACTCCACGTGGCAGG + Intronic
1049381706 8:142319533-142319555 AGGCACACACACCAAGTGCAGGG + Intronic
1053071721 9:35105929-35105951 GGGCAAACTCACCACTTGGACGG + Exonic
1061584062 9:131555019-131555041 GCGGCCACTCACCACGGGGAAGG - Intergenic
1192227352 X:69238470-69238492 GGGCACACACACCAGCTGGCAGG - Intergenic
1195937829 X:110142240-110142262 GGGCTAAATCACCATGTGGAGGG + Intronic
1196960844 X:120999779-120999801 GGGCACGCTCACAAACTGGATGG + Intergenic