ID: 902479426

View in Genome Browser
Species Human (GRCh38)
Location 1:16703937-16703959
Sequence ACTCACCACGTGGAGGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 2, 1: 1, 2: 0, 3: 13, 4: 160}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902479412_902479426 28 Left 902479412 1:16703886-16703908 CCAGCAGTCTGGCTTCAGTCTGC No data
Right 902479426 1:16703937-16703959 ACTCACCACGTGGAGGGTGCTGG 0: 2
1: 1
2: 0
3: 13
4: 160
902479418_902479426 -3 Left 902479418 1:16703917-16703939 CCCCTCTTCCTCCTGGGCACACT No data
Right 902479426 1:16703937-16703959 ACTCACCACGTGGAGGGTGCTGG 0: 2
1: 1
2: 0
3: 13
4: 160
902479419_902479426 -4 Left 902479419 1:16703918-16703940 CCCTCTTCCTCCTGGGCACACTC No data
Right 902479426 1:16703937-16703959 ACTCACCACGTGGAGGGTGCTGG 0: 2
1: 1
2: 0
3: 13
4: 160
902479415_902479426 2 Left 902479415 1:16703912-16703934 CCCTCCCCCTCTTCCTCCTGGGC No data
Right 902479426 1:16703937-16703959 ACTCACCACGTGGAGGGTGCTGG 0: 2
1: 1
2: 0
3: 13
4: 160
902479420_902479426 -5 Left 902479420 1:16703919-16703941 CCTCTTCCTCCTGGGCACACTCA No data
Right 902479426 1:16703937-16703959 ACTCACCACGTGGAGGGTGCTGG 0: 2
1: 1
2: 0
3: 13
4: 160
902479417_902479426 -2 Left 902479417 1:16703916-16703938 CCCCCTCTTCCTCCTGGGCACAC No data
Right 902479426 1:16703937-16703959 ACTCACCACGTGGAGGGTGCTGG 0: 2
1: 1
2: 0
3: 13
4: 160
902479416_902479426 1 Left 902479416 1:16703913-16703935 CCTCCCCCTCTTCCTCCTGGGCA No data
Right 902479426 1:16703937-16703959 ACTCACCACGTGGAGGGTGCTGG 0: 2
1: 1
2: 0
3: 13
4: 160
902479411_902479426 29 Left 902479411 1:16703885-16703907 CCCAGCAGTCTGGCTTCAGTCTG No data
Right 902479426 1:16703937-16703959 ACTCACCACGTGGAGGGTGCTGG 0: 2
1: 1
2: 0
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902479426 Original CRISPR ACTCACCACGTGGAGGGTGC TGG Intergenic
900175663 1:1290372-1290394 ACTCACCCCAGGCAGGGTGCCGG - Exonic
900216902 1:1486466-1486488 ACACTCCAGGTGGAGTGTGCAGG + Intronic
901054930 1:6444666-6444688 ACTCACCACATGGAGGGTGCTGG - Exonic
901249904 1:7770287-7770309 ACAGACCACCTAGAGGGTGCAGG - Intergenic
902479426 1:16703937-16703959 ACTCACCACGTGGAGGGTGCTGG + Intergenic
902880230 1:19367327-19367349 ACTCAACAAGTGGTGGCTGCTGG + Intronic
903207915 1:21796638-21796660 ACCCAGGACGTGGAGGTTGCAGG + Intergenic
903215098 1:21839369-21839391 ACTCTCCACGTGCAGGATGATGG + Exonic
903694945 1:25199651-25199673 TCTCCCCACGTGGAGGATGGGGG + Intergenic
904306497 1:29593419-29593441 GCTCACTATGTGGGGGGTGCTGG + Intergenic
904530868 1:31168231-31168253 ACTCAAGAGGTGGAGGTTGCAGG - Intergenic
906987067 1:50694883-50694905 ACCCAACAGGTGGAGGTTGCAGG + Intronic
907124200 1:52034838-52034860 ACTCAGGAGGTGGAGGTTGCAGG - Intronic
914442438 1:147719184-147719206 ACTCAGCAAGTTTAGGGTGCAGG + Intergenic
915064554 1:153214059-153214081 ACCCAGCAGGTGGAGGTTGCAGG - Intergenic
915598545 1:156908575-156908597 ACTGACCACGCGGAGGGGTCGGG + Intronic
916751041 1:167722571-167722593 AGTCACCACGAGGAGAGGGCAGG - Intronic
923112078 1:230899050-230899072 TCTCCCAACGTGGTGGGTGCAGG - Intergenic
923746408 1:236704727-236704749 ACTGAACACGTGGAGGTTCCTGG - Intronic
1062994726 10:1855099-1855121 ACTCAGGAGGTGGAGGTTGCAGG + Intergenic
1063558081 10:7099719-7099741 CCTGACCTGGTGGAGGGTGCAGG - Intergenic
1063925524 10:10973496-10973518 ACTCACCATGTGGAAGAGGCAGG + Intergenic
1065494858 10:26317680-26317702 ACTCAGGAGGTGGAGGTTGCGGG - Intergenic
1067713238 10:48667095-48667117 ACTCACTATGTGCTGGGTGCTGG + Intergenic
1068438159 10:57017512-57017534 ACTCAGCAAGTTTAGGGTGCAGG + Intergenic
1070251644 10:74778557-74778579 ACTCAGCAAGTTTAGGGTGCAGG + Intergenic
1070850984 10:79561289-79561311 CCACACCATGTGGTGGGTGCTGG + Intergenic
1070856215 10:79609985-79610007 CCACACCATGTGGTGGGTGCTGG - Intergenic
1073081402 10:100863236-100863258 ACTTCCCACGTGGAGAGGGCTGG + Intergenic
1076229065 10:128804942-128804964 AATCACCATGTGGAAGTTGCTGG + Intergenic
1081049777 11:38324165-38324187 ACTCAGCAAGTTTAGGGTGCAGG + Intergenic
1086319201 11:85627780-85627802 CTTCATCGCGTGGAGGGTGCAGG - Intronic
1088367944 11:109058581-109058603 GCTCACCAAGTAGAGGGAGCAGG - Intergenic
1093254542 12:16850614-16850636 GCTCACCAAGTGGAGGTTCCTGG - Intergenic
1093468275 12:19473480-19473502 ACACAGCAGGTGGAGGCTGCAGG - Intronic
1095825874 12:46530642-46530664 GCCCACCCCGTGGAGGGCGCCGG + Intergenic
1096542210 12:52314243-52314265 GCTCACCACTTGGTGGGTGTGGG + Intergenic
1096974645 12:55693135-55693157 CCTCACCAGGTGGAGGATGTTGG + Exonic
1103604693 12:122078377-122078399 ACCCACCACGTGGAGCCGGCCGG + Intergenic
1104757197 12:131276715-131276737 GCTCACCAGGTGATGGGTGCAGG - Intergenic
1104850016 12:131868359-131868381 CAGCACCCCGTGGAGGGTGCAGG - Intergenic
1107217461 13:37937814-37937836 ACCCAGCAGGTGGAGGTTGCAGG + Intergenic
1111161430 13:84399500-84399522 ACTCAGCAAGTTTAGGGTGCAGG + Intergenic
1112368791 13:98776680-98776702 ACTCAGGAGGTGGAGGTTGCAGG + Intergenic
1112873948 13:104012134-104012156 CCTCACCCAGTGGAGGGTGGAGG - Intergenic
1113562873 13:111297670-111297692 ACTCACCACGAGGGGCGTCCTGG + Intronic
1117438678 14:55741084-55741106 TCTCACCACTTGGAGCGTGGAGG - Intergenic
1119004023 14:70907987-70908009 ACTCACCATGTAGAGGGTGAAGG - Exonic
1119552495 14:75525172-75525194 ACTTACCAGGTGCAGGGTGTCGG - Exonic
1119748274 14:77059779-77059801 GCTCCCCACGTGGATGGAGCTGG - Intergenic
1120506405 14:85358079-85358101 ACTGACCATGTGGAGGTTTCTGG - Intergenic
1121405283 14:93715940-93715962 ACTCACCAGGTTGAAGGAGCTGG + Intergenic
1127285861 15:57533184-57533206 ACTCTCCATGAGGAGGGTGGAGG - Intronic
1129328699 15:74815936-74815958 ACTGACGACGTGGATGGTGCTGG + Intronic
1129761157 15:78130172-78130194 ACTCCCCAGGCGGAGGGGGCAGG - Intronic
1130246268 15:82252452-82252474 AATCACCTGGTGGAGGGGGCAGG + Intronic
1130454365 15:84090508-84090530 AATCACCTGGTGGAGGGGGCAGG - Intergenic
1131049361 15:89335979-89336001 CCTCTCCACGTGGCGGGAGCAGG - Intergenic
1131252357 15:90838873-90838895 ACTCACAAAGTGGGGGGTGGGGG - Intergenic
1132229632 15:100171760-100171782 GCTCACCACATGGAAGGGGCTGG + Intronic
1132614110 16:831871-831893 ACTCACAGGGCGGAGGGTGCCGG - Intergenic
1132843919 16:1991300-1991322 ACCCACCACGTGCAGGAAGCTGG + Intronic
1135256739 16:20947241-20947263 GCTGACCACGTGGAGGTTCCTGG + Intronic
1135678779 16:24439493-24439515 GCTGACCACGTGGAGGTTCCTGG + Intergenic
1140327544 16:74019789-74019811 ACCCAACACCTGGAGGGTGGTGG - Intergenic
1141469245 16:84227498-84227520 ACTCAGGAGGTGGAGGTTGCAGG + Intronic
1141702439 16:85648678-85648700 GGTCACCACGGGGGGGGTGCTGG - Exonic
1141763487 16:86044163-86044185 ACGCACCCCGTGGTGGGTGCCGG + Intergenic
1141786707 16:86205641-86205663 ACTCCCCACGGGCAGGGTGGTGG + Intergenic
1142296929 16:89230284-89230306 CCTCCCCACGTGGGGGGTGGTGG - Exonic
1144589783 17:16514347-16514369 ACTCAACACGTGCAGGGTGGAGG + Intergenic
1144767720 17:17741789-17741811 ACTCCCCACATCCAGGGTGCTGG + Intronic
1146860105 17:36289903-36289925 GCTGAACACGTGGAGGGTCCTGG + Intronic
1147090431 17:38093994-38094016 GCTGAACACGTGGAGGGTCCTGG + Intergenic
1147106782 17:38226532-38226554 GCTGAACACGTGGAGGGTCCTGG - Intergenic
1148422742 17:47562005-47562027 GCTGAACACGTGGAGGGTCCTGG + Intronic
1148514789 17:48206362-48206384 ACTGACCACGTGGAGGTTCCTGG - Intronic
1149703784 17:58677040-58677062 ACTCAGGAGGTGGAGGGTGCTGG + Intronic
1150306080 17:64086721-64086743 ACTCAGGAGGTGGAGGTTGCAGG - Intronic
1151490102 17:74427703-74427725 ACTCCCCAGGTAGAGGGAGCAGG + Intronic
1152699675 17:81812741-81812763 AAGCTCCACGTGGATGGTGCGGG + Intronic
1152738641 17:82009390-82009412 ACTCCCACCCTGGAGGGTGCAGG + Intronic
1155802824 18:30130925-30130947 ACTCACCAAGCTGAGGGTGGTGG + Intergenic
1156382512 18:36577377-36577399 ACTCAGGAGGTGGAGGTTGCAGG - Intronic
1160384265 18:78485499-78485521 ACTCATCAGGAGGAGGCTGCAGG - Intergenic
1160483178 18:79261589-79261611 TCTCACCATCTGGAAGGTGCAGG - Intronic
1161318935 19:3632228-3632250 TGTCTCCACGTGGAGGGGGCGGG + Exonic
1162165052 19:8746858-8746880 TCTCCCCACATGGAAGGTGCTGG - Intergenic
1162166118 19:8754309-8754331 TCTCCCCACATGGAAGGTGCTGG - Intergenic
1162167184 19:8761765-8761787 TCTCCCCACATGGAAGGTGCTGG - Intergenic
1162169193 19:8775521-8775543 TCTCCCCACATGGAAGGTGCTGG - Intergenic
1162169873 19:8780832-8780854 TCTCCCCACATGGAAGGTGCTGG - Intergenic
1162170936 19:8788291-8788313 TCTCCCCACATGGAAGGTGCTGG - Intergenic
1162879387 19:13646875-13646897 ACTCACGACATTGAGGTTGCAGG - Intergenic
1162923573 19:13918560-13918582 TCTCACCGGGTGGAGGGGGCAGG - Exonic
1165895524 19:39138930-39138952 ACTGACCCACTGGAGGGTGCTGG - Intronic
1166124209 19:40703938-40703960 ACTCACCACATGCAGGGCCCTGG + Intronic
1166284111 19:41813128-41813150 TCTCAGGACCTGGAGGGTGCTGG - Intergenic
1166409789 19:42548848-42548870 TCTCAGGACCTGGAGGGTGCTGG + Intronic
1166931996 19:46306870-46306892 GCTCACCATGTGAATGGTGCTGG - Intronic
1202713465 1_KI270714v1_random:29843-29865 ACTCACCACGTGGAGGGTGCTGG + Intergenic
924982908 2:239408-239430 ATACACCACGTGGAAGGTACGGG + Intronic
926395373 2:12435995-12436017 ACATACCACGTGGGGCGTGCCGG + Intergenic
927635037 2:24808283-24808305 ACCCAGGAGGTGGAGGGTGCCGG - Intronic
928171286 2:29004517-29004539 ACTGACCACGGGGATGTTGCTGG - Intronic
929588992 2:43133166-43133188 GCTCAGCAGGTGCAGGGTGCGGG + Intergenic
929956200 2:46460514-46460536 GCTGACCACGTGGTGGGAGCTGG - Intronic
934857270 2:97737196-97737218 CCTCAGCACGTCGAGGGTGCAGG + Intronic
939407268 2:141774447-141774469 AATCACCGCGGGGATGGTGCTGG + Intronic
943688316 2:190842755-190842777 ACTCACCACCTGGCAGGTGAAGG + Intergenic
948659363 2:239497627-239497649 AATCACCCAGTGGAGGGTGGTGG + Intergenic
1175675285 20:60941455-60941477 CATCACTACGTGGAGGCTGCCGG + Intergenic
1175790841 20:61738939-61738961 ACCCGCCGCGTGGAGGCTGCAGG + Intronic
1176159487 20:63641170-63641192 ACTCACCACGAGGACAGGGCAGG + Exonic
1180248076 21:46561862-46561884 CATCACCCCGTGGAGGGTGCTGG + Intronic
1181058829 22:20272408-20272430 TCCCACCACCTGGAGGCTGCTGG + Intronic
1181647164 22:24238150-24238172 ACCCAGCAGGTGGAGGTTGCAGG + Intronic
1181778995 22:25179141-25179163 ACTCACCACGAGGACAGGGCAGG + Intronic
1185214559 22:49591008-49591030 AGGCACCACGTGCAGGGAGCAGG - Intronic
958431894 3:94049506-94049528 ACTCACCAGGAGGAGGGGGTGGG - Exonic
959071031 3:101702126-101702148 ACTCAGCCCGTGGAGGCAGCTGG + Intergenic
961368791 3:126417463-126417485 ACTCCCCAGGTGGAGGCTGGAGG - Intronic
961389792 3:126545687-126545709 ACTGACCCCTTGGAGTGTGCTGG - Intronic
962164957 3:133038720-133038742 CCTCCCCAGGTGGAGGGTGCGGG + Intronic
965701183 3:171460428-171460450 ACTCAGCAGGGGGAGGGTGGGGG + Intergenic
966705873 3:182912773-182912795 AATCACCATGTGCTGGGTGCAGG - Intronic
966962514 3:184954236-184954258 ACTGAACATGTGGAGGGTCCTGG - Intronic
968942016 4:3643811-3643833 ACACTCCAGGTGGCGGGTGCTGG + Intergenic
973292289 4:48483088-48483110 ACACACAAAGTGGAGGGGGCGGG - Intergenic
974278658 4:59760387-59760409 ACTCAGCAGGCGGAGGTTGCAGG - Intergenic
975177091 4:71300881-71300903 GCTCAGCACGTGGTAGGTGCTGG + Intronic
979472870 4:121122109-121122131 ACTCACCCCGTGGAAGTTGGGGG + Intergenic
986968157 5:13300849-13300871 ACTCATTAAGTGGAGGTTGCAGG - Intergenic
998253415 5:140567504-140567526 ACTCAGCACCTGGTAGGTGCTGG - Exonic
1001805583 5:174583002-174583024 ACTCAGGAGGTGGAGGTTGCAGG - Intergenic
1003569692 6:7247758-7247780 ACCCACCACCTGCAGGGTGGAGG + Intronic
1003877493 6:10451397-10451419 GCTGACCACGTGGAGGTTCCTGG + Intergenic
1004039429 6:11961103-11961125 TTTGACCACGTGGAGGGTGGAGG - Intergenic
1005152850 6:22772597-22772619 GCTCACCACGTGGAGGTTACTGG + Intergenic
1005852864 6:29835231-29835253 ACTCCTCACATGGTGGGTGCTGG - Intergenic
1019167850 6:170110745-170110767 CTTCACCACGTGGATGGAGCTGG + Intergenic
1019295595 7:272389-272411 GCTCAGCACGTGAGGGGTGCTGG - Intergenic
1019383687 7:741449-741471 ACTCACCATGTGGAGGGTAATGG - Exonic
1020747219 7:12092641-12092663 ACTCAGCAAGTTTAGGGTGCAGG + Intergenic
1022504628 7:30902598-30902620 TGTCACTAGGTGGAGGGTGCAGG + Intergenic
1023069815 7:36418162-36418184 ACTGAACACGTGGAGGTTCCTGG - Intronic
1029458698 7:100683624-100683646 CCTCACCACCTGCAGGGGGCAGG + Exonic
1033797103 7:144858918-144858940 ACTCAGGAGGTGGAGGTTGCAGG + Intergenic
1035424375 7:158758321-158758343 TCTCAGAACGTGGAAGGTGCTGG + Intronic
1038875032 8:31539230-31539252 ACTTGGCACATGGAGGGTGCTGG - Intergenic
1045217526 8:100163085-100163107 ACTGATCACATGGAGGGTGGTGG + Intronic
1045297158 8:100882160-100882182 ACTCAGCAAGTTTAGGGTGCAGG - Intergenic
1045959611 8:107951815-107951837 ACTCAGAACGTGGAGGATGAGGG - Intronic
1047409913 8:124615901-124615923 ACTGACCAGGAGAAGGGTGCTGG - Intronic
1048201007 8:132373933-132373955 ACCCACCTCGGGGAGGGTGGTGG - Intronic
1052786100 9:32830073-32830095 ACACAGCAGCTGGAGGGTGCAGG + Intergenic
1055774684 9:79754742-79754764 ACTCAGCAGGCGGAGGTTGCAGG - Intergenic
1057260805 9:93582214-93582236 ACTCACCTCCCAGAGGGTGCAGG + Intronic
1058100464 9:100913829-100913851 AGTTGCCACGTGGAGGTTGCTGG + Intergenic
1061138614 9:128751065-128751087 CCTCCCCACCTGGAGGTTGCCGG - Intronic
1061194599 9:129100844-129100866 ATTCACCAAGTGCAGGGTGTGGG + Intronic
1061584058 9:131555013-131555035 ACTCACCACGGGGAAGGGGAAGG - Intergenic
1062502707 9:136858172-136858194 AAACACCACCTGGCGGGTGCAGG - Exonic
1186276093 X:7939657-7939679 ACTCAGCAGGTGGAGAGTGTTGG - Intergenic
1187435533 X:19265398-19265420 ACTCAGAAGGTGGAGGGTGGGGG - Intergenic
1188800613 X:34525095-34525117 GCTCAACATGTGGAGGCTGCTGG + Intergenic
1189561592 X:42196477-42196499 GCTCACCACGTGGAGAGTCCAGG + Intergenic
1190602601 X:52108096-52108118 ACTCACCACTGGGACTGTGCTGG + Intergenic
1192750463 X:73984989-73985011 TCGCTCCAGGTGGAGGGTGCTGG - Intergenic
1195264225 X:103164367-103164389 ACTAACAATGTGGAGGGGGCAGG + Intergenic
1198676447 X:139136348-139136370 ACTCAGAACGGGGAGGGTGGGGG - Intronic
1198970772 X:142276871-142276893 AGTCAACACGTGGAAAGTGCAGG - Intergenic
1200086652 X:153610375-153610397 AGACACGGCGTGGAGGGTGCGGG - Intergenic
1200149355 X:153943710-153943732 ACTCACCACCTGGAGGTTGGGGG + Exonic
1200256968 X:154587765-154587787 ACCCAGGAGGTGGAGGGTGCAGG + Intergenic
1200260801 X:154616637-154616659 ACCCAGGAGGTGGAGGGTGCAGG - Intergenic