ID: 902479428

View in Genome Browser
Species Human (GRCh38)
Location 1:16703950-16703972
Sequence AGGGTGCTGGCCCTTGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902479415_902479428 15 Left 902479415 1:16703912-16703934 CCCTCCCCCTCTTCCTCCTGGGC No data
Right 902479428 1:16703950-16703972 AGGGTGCTGGCCCTTGATGCTGG No data
902479421_902479428 2 Left 902479421 1:16703925-16703947 CCTCCTGGGCACACTCACCACGT 0: 2
1: 1
2: 0
3: 10
4: 122
Right 902479428 1:16703950-16703972 AGGGTGCTGGCCCTTGATGCTGG No data
902479416_902479428 14 Left 902479416 1:16703913-16703935 CCTCCCCCTCTTCCTCCTGGGCA No data
Right 902479428 1:16703950-16703972 AGGGTGCTGGCCCTTGATGCTGG No data
902479418_902479428 10 Left 902479418 1:16703917-16703939 CCCCTCTTCCTCCTGGGCACACT No data
Right 902479428 1:16703950-16703972 AGGGTGCTGGCCCTTGATGCTGG No data
902479419_902479428 9 Left 902479419 1:16703918-16703940 CCCTCTTCCTCCTGGGCACACTC No data
Right 902479428 1:16703950-16703972 AGGGTGCTGGCCCTTGATGCTGG No data
902479423_902479428 -1 Left 902479423 1:16703928-16703950 CCTGGGCACACTCACCACGTGGA 0: 2
1: 1
2: 0
3: 15
4: 106
Right 902479428 1:16703950-16703972 AGGGTGCTGGCCCTTGATGCTGG No data
902479420_902479428 8 Left 902479420 1:16703919-16703941 CCTCTTCCTCCTGGGCACACTCA No data
Right 902479428 1:16703950-16703972 AGGGTGCTGGCCCTTGATGCTGG No data
902479417_902479428 11 Left 902479417 1:16703916-16703938 CCCCCTCTTCCTCCTGGGCACAC No data
Right 902479428 1:16703950-16703972 AGGGTGCTGGCCCTTGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902479428 Original CRISPR AGGGTGCTGGCCCTTGATGC TGG Intergenic
No off target data available for this crispr