ID: 902482233

View in Genome Browser
Species Human (GRCh38)
Location 1:16718067-16718089
Sequence GTCGAGTCACATGCTGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902482228_902482233 13 Left 902482228 1:16718031-16718053 CCAGCCTGGCAACCACAGAAAGA No data
Right 902482233 1:16718067-16718089 GTCGAGTCACATGCTGCTGTGGG No data
902482227_902482233 14 Left 902482227 1:16718030-16718052 CCCAGCCTGGCAACCACAGAAAG No data
Right 902482233 1:16718067-16718089 GTCGAGTCACATGCTGCTGTGGG No data
902482226_902482233 24 Left 902482226 1:16718020-16718042 CCTGCATAAGCCCAGCCTGGCAA No data
Right 902482233 1:16718067-16718089 GTCGAGTCACATGCTGCTGTGGG No data
902482230_902482233 1 Left 902482230 1:16718043-16718065 CCACAGAAAGACACCTTCTTATC No data
Right 902482233 1:16718067-16718089 GTCGAGTCACATGCTGCTGTGGG No data
902482229_902482233 9 Left 902482229 1:16718035-16718057 CCTGGCAACCACAGAAAGACACC No data
Right 902482233 1:16718067-16718089 GTCGAGTCACATGCTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902482233 Original CRISPR GTCGAGTCACATGCTGCTGT GGG Intergenic
No off target data available for this crispr