ID: 902486300

View in Genome Browser
Species Human (GRCh38)
Location 1:16748998-16749020
Sequence CACCCACCGCTGCCCGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 3, 1: 0, 2: 1, 3: 12, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902486291_902486300 20 Left 902486291 1:16748955-16748977 CCACGTCCCAGGGCTGGGGGCGC 0: 3
1: 0
2: 6
3: 38
4: 306
Right 902486300 1:16748998-16749020 CACCCACCGCTGCCCGGCACTGG 0: 3
1: 0
2: 1
3: 12
4: 195
902486295_902486300 13 Left 902486295 1:16748962-16748984 CCAGGGCTGGGGGCGCTGTGGGC 0: 3
1: 4
2: 7
3: 85
4: 568
Right 902486300 1:16748998-16749020 CACCCACCGCTGCCCGGCACTGG 0: 3
1: 0
2: 1
3: 12
4: 195
902486293_902486300 14 Left 902486293 1:16748961-16748983 CCCAGGGCTGGGGGCGCTGTGGG 0: 3
1: 0
2: 5
3: 86
4: 624
Right 902486300 1:16748998-16749020 CACCCACCGCTGCCCGGCACTGG 0: 3
1: 0
2: 1
3: 12
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902486300 Original CRISPR CACCCACCGCTGCCCGGCAC TGG Intronic
900147103 1:1163150-1163172 CACCCACCCGGGCCTGGCACAGG + Intergenic
900299208 1:1968716-1968738 CCCCCACCAGTGCCAGGCACCGG - Exonic
900344198 1:2203374-2203396 CACCCATGGCTGCCCTGCCCAGG + Intronic
900363527 1:2301206-2301228 CACCCGCCCCTGCCAGGCATAGG + Intronic
900484508 1:2915030-2915052 CACCCACCCCTGCAGGGCTCAGG - Intergenic
900507537 1:3037203-3037225 CACCCACCCCTCCCCAGCACAGG + Intergenic
901242750 1:7704589-7704611 CACCAGCCTCTGCCCGGCTCCGG + Intronic
902451405 1:16499059-16499081 CGCCCGCCGCTGCCCGGCACCGG - Intergenic
902472505 1:16658448-16658470 CACCCACCGCTGCCCGGCACCGG - Intergenic
902486300 1:16748998-16749020 CACCCACCGCTGCCCGGCACTGG + Intronic
902508972 1:16955352-16955374 CTCCCGCCGCAGCCCGTCACGGG - Exonic
902607419 1:17576358-17576380 CACCCAGAGCAGCCCGGCATTGG - Intronic
902833356 1:19032174-19032196 CACCCACCGCTTTCCAGCAAGGG + Intergenic
904749752 1:32734189-32734211 CACCCACCCCATCCCAGCACTGG - Intergenic
905551612 1:38845463-38845485 CACCCACCCCTGACAGGCCCTGG - Intronic
906580794 1:46933999-46934021 TACCCACCGGTGCCAGGCATTGG - Exonic
906602930 1:47144895-47144917 TACCCACCGGTGCCAGGCATTGG + Exonic
912625972 1:111204547-111204569 CACCCCACGCTGCCCTGCCCAGG - Intronic
918015990 1:180632535-180632557 CTCCCACCGTTCCCCGGCCCCGG - Intronic
920706044 1:208251233-208251255 CACCCACCCCTGCAAGGCCCTGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1063369857 10:5514128-5514150 CACCCACCACCCCCCAGCACAGG + Intergenic
1066026332 10:31363087-31363109 CACCCAGAGCTGCCGGCCACAGG - Intronic
1067092223 10:43273668-43273690 CACCCACCGCCCCCTTGCACAGG - Intergenic
1067946959 10:50695749-50695771 CACCCAGAGCTGCCGGCCACGGG + Intergenic
1069594105 10:69659501-69659523 GACCCCACGCTGCCCGGCTCTGG + Intergenic
1069898935 10:71695969-71695991 CCCCCACGGCTGCCCAGCAGGGG + Intronic
1070882269 10:79860742-79860764 CACCCAGAGCTGCCGGCCACGGG + Intergenic
1071648839 10:87377053-87377075 CACCCAGAGCTGCCGGCCACAGG + Intergenic
1071778460 10:88815817-88815839 CATCCACCTCTACCCTGCACTGG + Intronic
1075696487 10:124439696-124439718 CTCCCACCTCAGCCTGGCACAGG + Intergenic
1076317089 10:129550315-129550337 CCACCACCGCCGCCCAGCACCGG + Intronic
1076365659 10:129919866-129919888 CATCTACAGGTGCCCGGCACTGG - Intronic
1076888649 10:133273755-133273777 CACCCACCTGAGGCCGGCACAGG + Exonic
1076904312 10:133354690-133354712 ATCCCACCTCTGCCTGGCACTGG + Intergenic
1077143915 11:1036438-1036460 CAGCCCCCGCTGCCAGGCCCGGG - Intronic
1077216680 11:1397978-1398000 CTCCCACCTCTGCCCGGGGCCGG - Intronic
1077358187 11:2128221-2128243 CACCCTCCAGTGCCCGGCACAGG + Intergenic
1078461743 11:11519912-11519934 AACCCACCTCTGTCAGGCACTGG - Intronic
1079135921 11:17775936-17775958 CAGCCACTGCTGCCCAGCAGGGG - Intronic
1080581286 11:33645969-33645991 CACCCACTGCACCCCGGCCCTGG - Exonic
1083304790 11:61756604-61756626 CCCCCACCCCTGCCCTGCACTGG - Intronic
1083424701 11:62577197-62577219 CACCCTCCGCTGCTGGGCTCAGG - Exonic
1083849008 11:65354700-65354722 CACCCGCCGCAGCCCCGCCCCGG - Intergenic
1085143535 11:74171467-74171489 CGCCCACCTCTACCCGGCAGCGG + Exonic
1085465773 11:76722285-76722307 CACCCACTGCTGCCAGGCTCTGG + Intergenic
1089256308 11:117196156-117196178 CCAGCACCGCTGCCCAGCACTGG + Exonic
1089602853 11:119625876-119625898 TACCCTCCCCTGCCAGGCACTGG - Intronic
1090877522 11:130804380-130804402 CACCCACAGCTGTGGGGCACAGG + Intergenic
1092252697 12:6909615-6909637 AACCCACCCCTACCCGGCCCAGG - Intronic
1093706131 12:22276598-22276620 CCCCCACCCCTGCCCGACTCTGG + Intronic
1096470120 12:51870292-51870314 CACCCACAGCTTCCCTGCAAAGG + Intergenic
1096717365 12:53499525-53499547 CTCCCCCCGCTGCCCTCCACCGG + Intronic
1103738619 12:123076958-123076980 CTCCGACCCATGCCCGGCACAGG - Intronic
1105642841 13:22284220-22284242 TCCCCACCGCTCCCCGGCCCTGG + Intergenic
1107925010 13:45250559-45250581 TACCCACTTCTGCCAGGCACTGG - Intronic
1110626692 13:77661664-77661686 CACCCAAAGCTGCCGGCCACAGG - Intergenic
1114618423 14:24080951-24080973 CACCCCCCAGTGCCTGGCACTGG + Exonic
1117978495 14:61320870-61320892 CACCCAGCTCTGCGCGGCAAGGG - Intronic
1118894784 14:69936601-69936623 CATCCAACGCTGGCCGGCAATGG - Intronic
1120914794 14:89701674-89701696 CCCCCCCCGCTTCCCGGCGCCGG + Intergenic
1122399490 14:101458530-101458552 CCCCCTCCGGTGCCCGGCGCTGG + Intergenic
1123630680 15:22258029-22258051 CACCGGCCGCTGCTGGGCACGGG + Intergenic
1129107946 15:73322169-73322191 CTCCCACCCCTGCCCAGCCCCGG + Exonic
1130044933 15:80436132-80436154 CACCTACCGCTGCCCCACCCAGG - Intronic
1130253508 15:82315393-82315415 CAGCCACTGCTGCCCCGCAGAGG + Intergenic
1130691577 15:86085974-86085996 CACCCACCTCTGCAGGGCAGAGG + Intergenic
1130931031 15:88428196-88428218 CATCCAGGGCTGCCCGGCCCCGG - Intergenic
1138505430 16:57476023-57476045 CAGCCACCCCTGCCTGCCACAGG + Intronic
1139404415 16:66706784-66706806 CACCCCCCGGGGCCAGGCACTGG + Intergenic
1139437395 16:66944029-66944051 CACCCCCTCCTCCCCGGCACAGG - Exonic
1139842431 16:69892348-69892370 CACCCACCCCTGACAGGCCCCGG + Intronic
1141248078 16:82329387-82329409 CACCCACTGCTGCCCTACAAAGG - Intergenic
1141750952 16:85957479-85957501 CACCCACCGCTGCTTGGCTGGGG + Intergenic
1142036021 16:87862472-87862494 CACCCACCCACGCTCGGCACAGG - Intronic
1143025813 17:3941507-3941529 CACGCTGCGCTGCCTGGCACTGG - Exonic
1143499210 17:7329242-7329264 CCCCCACCCCCGCCCGGCCCCGG + Exonic
1144044989 17:11447438-11447460 CCCCCACAGCTTCCCGGAACTGG + Intronic
1144760530 17:17704499-17704521 CACACCCCACTGCCCGGCACGGG - Intronic
1145886888 17:28388182-28388204 CACTCCCCGCTGCCCTGTACTGG + Exonic
1147763931 17:42820182-42820204 TACCCACAGCTGCCAGTCACTGG - Intronic
1147931380 17:43983672-43983694 CACCCAACGCTCCCCGGGGCCGG + Intronic
1148216497 17:45836432-45836454 CACCCACCTCAGAGCGGCACTGG - Intergenic
1148237294 17:45977281-45977303 TCCCCACCGCTGGCCAGCACAGG - Intronic
1148497409 17:48061220-48061242 CCCTCACCCCTGCCCGGCTCTGG + Exonic
1148688700 17:49514580-49514602 CAACCACCGCTCCCCAGCCCAGG + Exonic
1149993549 17:61395835-61395857 CCCCCACCGCCGCCCGTCGCAGG + Intergenic
1150226413 17:63527039-63527061 CACCCACGCCTGCCCCGCACTGG + Intronic
1152287765 17:79422480-79422502 CACCCAGGGCTTCCCGGCCCAGG + Intronic
1152476547 17:80522126-80522148 CACCCACCGCCCCCAGGCCCTGG + Intergenic
1152542268 17:80982277-80982299 GACCCACGGCTGCCTGGCCCAGG - Intergenic
1152613725 17:81328585-81328607 CCCACACTGCTGCCCAGCACGGG - Intronic
1153688355 18:7567776-7567798 CACCCACCGCCGCCGGGGAGCGG + Exonic
1160196426 18:76759217-76759239 CACCGTCCTCTCCCCGGCACGGG + Intergenic
1160302705 18:77700193-77700215 CACCCACAGCTCCCCTGCGCTGG - Intergenic
1160979921 19:1812172-1812194 CACCCGCCGCTCACCGGCGCAGG + Exonic
1161161754 19:2765539-2765561 CAGCCACCGTCGCCAGGCACAGG - Intronic
1161218310 19:3105736-3105758 CACAGACCGCTGCTCGGCGCTGG - Intronic
1161332470 19:3694861-3694883 CGCCCAACGCAGCCCGGCTCTGG + Intronic
1161770938 19:6230383-6230405 CAGCCACCACGCCCCGGCACAGG + Intronic
1162346855 19:10123848-10123870 GACCCACCCGTGCCCGGCCCAGG + Intergenic
1162562604 19:11426303-11426325 CACCTACCACTGCCCGCCGCAGG + Intronic
1163427251 19:17246181-17246203 CTCCCGCCGCGGCCCGGCAGGGG - Intronic
1165365496 19:35362601-35362623 CAACCTCCGCTGGCTGGCACTGG - Intergenic
1165935282 19:39385091-39385113 CACCCCACCCAGCCCGGCACTGG - Intronic
1166796650 19:45430172-45430194 TCCCCAGCGCTGCCCAGCACAGG + Intronic
1167643820 19:50695380-50695402 CCCCCTCCGCCGCCCGGCGCAGG - Intronic
1202704896 1_KI270713v1_random:15253-15275 CACCCACCGCTGCCCGGCACCGG - Intergenic
926905233 2:17799405-17799427 CACCCTCAGCTGCCCAGCACTGG - Intronic
932063248 2:68528502-68528524 CACCCAGAGCTGCCGGCCACAGG - Intronic
932336465 2:70934478-70934500 CACCCACCCCCGCCCTCCACAGG + Intergenic
936151190 2:110023241-110023263 CACCTACCGCAGCCGGGCCCTGG - Intergenic
936193485 2:110348128-110348150 CACCTACCGCAGCCGGGCCCTGG + Intergenic
942143416 2:173001315-173001337 TACCCAGCTTTGCCCGGCACTGG + Exonic
947015245 2:225612423-225612445 CACCCACCTCTGACTGGCATTGG + Intronic
948830272 2:240595208-240595230 CACCCACCAGTGCCCGGGCCCGG - Exonic
948903368 2:240966950-240966972 CTCCCACCGCTGCCAGCCCCAGG + Intronic
948909715 2:240996934-240996956 CTCCCACCTCTGGCTGGCACAGG - Intergenic
1169367128 20:5001119-5001141 TACCCACCCCTTCCCGCCACGGG - Intronic
1169586408 20:7090750-7090772 CACCAACCTCTGCCTGGCAATGG + Intergenic
1171411047 20:24949304-24949326 CACAAACCATTGCCCGGCACTGG + Exonic
1175730752 20:61352490-61352512 CACACCCCGCTGGCAGGCACGGG - Intronic
1175898428 20:62350447-62350469 CTCCCGCCTCTGCTCGGCACTGG + Intronic
1175909283 20:62396960-62396982 CACCCAGCGCTGCCTGAGACTGG + Intronic
1175941379 20:62539020-62539042 CCCCCACCCCTGCCCCGCTCCGG + Intergenic
1175941395 20:62539057-62539079 CCCCCACCCCTGCCCCGCTCTGG + Intergenic
1175974813 20:62705447-62705469 CCTCCAACACTGCCCGGCACGGG - Intergenic
1176052493 20:63127488-63127510 CACCCACCTCTGCCCACCGCTGG - Intergenic
1176077865 20:63256762-63256784 CCCCCACCCTTGCCCGGAACTGG + Intronic
1176271269 20:64236277-64236299 CACCCACCGCGGCCAGCCCCGGG - Intronic
1179529607 21:42009826-42009848 CCCCAACCCCTGCCCGGAACAGG + Intronic
1179576941 21:42313665-42313687 CACTCACCGCAGCCCAGCAAGGG - Intronic
1179716645 21:43291888-43291910 CAGCCACCGCTGCCTGGGCCCGG - Intergenic
1180076871 21:45467541-45467563 CACCCAGCGCTGTCGGTCACCGG - Intronic
1180612537 22:17107344-17107366 CACCCCCTGCCCCCCGGCACTGG + Intronic
1181829902 22:25551909-25551931 CACCCACCCCTGACAGGCCCTGG + Intergenic
1183193424 22:36336451-36336473 CATCCCCCGCTGCCTGGCAAGGG + Intronic
1183364100 22:37398164-37398186 CGCCCACAGCTGCCTGGCTCTGG - Intronic
1183731857 22:39622673-39622695 CCCCCACCCCTGCCCAGTACCGG - Intronic
1184532979 22:45068539-45068561 CACCCACAGCTGGAGGGCACTGG + Intergenic
1185105562 22:48867580-48867602 CACCCACCGTTCCCAGGCCCCGG - Intergenic
1185376196 22:50483608-50483630 CACCCAGCCCTGCCCTGCCCTGG - Exonic
950636335 3:14317785-14317807 CACTCTCTGCTGCCCGGGACTGG + Intergenic
951803587 3:26623209-26623231 CAGCCACCCCGGCCCGGGACTGG + Exonic
952883102 3:37997695-37997717 CACCCACCCCTGCCCACCCCAGG - Intronic
953800871 3:46021503-46021525 CACCCTCCGCTGCCGGGTGCTGG - Exonic
954691483 3:52397862-52397884 CACCCACCTCCTCCCGGCCCTGG - Exonic
955219665 3:57013004-57013026 CACCCTCCGCAGCCTGGCCCGGG - Intronic
959695107 3:109240923-109240945 CTCCCACCGCTGACAGGCCCTGG - Intergenic
968563609 4:1297704-1297726 CACCCACGAGTGCCTGGCACAGG + Intronic
968727691 4:2255892-2255914 CACCCCCAGCTCCCCGGCAGCGG - Intronic
968945510 4:3661453-3661475 CACCTGCCCCTGCCCGGCACAGG - Intergenic
969584923 4:8085957-8085979 CACCCACCCCTGCCAGGTACAGG + Intronic
970412211 4:15819173-15819195 CACCCACCCCTGACAGGCCCTGG - Intronic
981513700 4:145584820-145584842 CACCCACCACTGCCTGAGACAGG - Intergenic
985748958 5:1663629-1663651 CACTCACCGCCGCCCCTCACCGG - Intergenic
986784141 5:11096318-11096340 CCCCCACCCCTGCCAGGCCCCGG + Intronic
997972940 5:138419167-138419189 CACCCTCCTCCGCCCTGCACTGG + Exonic
998140423 5:139696914-139696936 CACCCTCCCCTGCCCACCACAGG - Intergenic
998433633 5:142088329-142088351 CACTCACTACTGCCCGTCACCGG + Intergenic
998629294 5:143880599-143880621 CACCCACCCCTTCCCGTCATAGG - Intergenic
999594833 5:153191512-153191534 CACCCACCGGTGCCTGTCATGGG + Intergenic
1002065956 5:176651732-176651754 CTGCCTCTGCTGCCCGGCACAGG + Exonic
1005243292 6:23855150-23855172 CACCCAGAGCTGCCGGCCACAGG + Intergenic
1006034743 6:31202537-31202559 CCCCCACAGCTGCCCAGCCCTGG - Exonic
1006442149 6:34059466-34059488 CAACCACCTCTGCCCAGCCCCGG + Intronic
1007114725 6:39335585-39335607 CACCCTCCGCTGCCCCTCCCTGG + Exonic
1013369801 6:109458848-109458870 CAGCCACAGCTTCCCGGCCCAGG - Intergenic
1019568013 7:1694227-1694249 TCCCCAGCCCTGCCCGGCACCGG - Exonic
1019593079 7:1845352-1845374 CTCCCTCCGCTGCCCTGCATGGG + Intronic
1019613375 7:1948004-1948026 CTCCCACCGCTCCCGGGCACTGG - Intronic
1020833101 7:13115235-13115257 CTCCCAAGGCTGCCCTGCACTGG + Intergenic
1022662755 7:32381816-32381838 TACCCACCACTACCCCGCACTGG + Intergenic
1025150219 7:56541523-56541545 CACACACCCCTGGCCAGCACTGG - Intergenic
1034469852 7:151249223-151249245 CACCCACCGCCGCCGGCCCCGGG - Intronic
1035231995 7:157470717-157470739 CACCCAACGCAGGCCAGCACCGG - Intergenic
1035418613 7:158709201-158709223 CCCTCACAGCTGCCCTGCACTGG - Intergenic
1037337099 8:17801727-17801749 CACCTACCGCGGCCCGGCCTGGG - Intergenic
1037435224 8:18855588-18855610 CAGCCACCACTGCCAGGCAAAGG + Intronic
1038319453 8:26514004-26514026 CTCCCAGCGCTGCCGGGAACTGG + Exonic
1038372927 8:27011409-27011431 CACCCAGAGCTGCCGGCCACAGG - Intergenic
1042143778 8:65706091-65706113 CACCCACCTCTGCCATGCCCAGG - Intronic
1047309274 8:123677907-123677929 CACACACCCCTGCCCTGCCCAGG - Intergenic
1049258904 8:141628315-141628337 CACACACCGCTGCCCTTCAGAGG - Intergenic
1049694796 8:143977878-143977900 CCCCCGCCCCTGCCCGGCTCAGG + Intronic
1049743430 8:144251977-144251999 CACCCGGCACTGCCCGGCAGAGG - Intronic
1053202686 9:36163493-36163515 CAGCCACAGCTGCCAGGAACAGG - Exonic
1056020194 9:82432177-82432199 CACCCAGAGCTGCCAGCCACAGG - Intergenic
1056475096 9:86945884-86945906 CACCCACCGCGCCCGGGCAGCGG - Exonic
1056572252 9:87825865-87825887 CACCCAGAGCTGCCAGCCACAGG + Intergenic
1057071704 9:92105141-92105163 CACCCAGAGCTGCCGGCCACAGG + Intronic
1057314599 9:93960374-93960396 CACCCACCGCTCGCCAGCCCCGG + Intergenic
1057490769 9:95517623-95517645 CACCCAAGGCCGCCTGGCACAGG - Intergenic
1057646800 9:96884148-96884170 CACCCACTTCTGCCAGGCAGAGG - Intergenic
1059061624 9:111039050-111039072 CTCCCAGCGCCGCCCTGCACTGG + Intergenic
1060361060 9:122958143-122958165 CCCTCACCCCTGCCCGGCTCTGG - Intronic
1060556802 9:124512200-124512222 CCCCCTCCGCTGCCCTGCACGGG - Intergenic
1060583357 9:124771013-124771035 CACCCACCGTTGCGCGGCGGCGG + Exonic
1060879494 9:127108063-127108085 CACCCCCCGCTGCCCCGCCCCGG - Exonic
1061057730 9:128233246-128233268 CAGCCACATCTGCCCGGCTCTGG - Intronic
1061203889 9:129152170-129152192 CACCCTCCGCTTCCCAGCCCAGG - Intergenic
1061648648 9:132027889-132027911 CACCCTCCACGGCCTGGCACAGG - Intronic
1062088424 9:134661067-134661089 CACCCACCACTGGCTGGCAGAGG + Intronic
1062394986 9:136349196-136349218 CACCCACTGCCGACAGGCACAGG - Intronic
1062572907 9:137193808-137193830 GAACCACCGCAGCCAGGCACAGG + Intronic
1203759436 EBV:4425-4447 CACTCCCCGCTGCCCGGCCAGGG - Intergenic
1185595948 X:1307093-1307115 CACCCACCTCTCTCCGGCTCAGG + Intronic
1185779213 X:2830127-2830149 CACCCACTGCTCCCGGGCGCAGG + Exonic
1199760220 X:150899014-150899036 CGCCTCCCGCTCCCCGGCACTGG - Intergenic
1200234891 X:154463525-154463547 CACCCACCGCCACCCACCACAGG - Intronic
1201077198 Y:10196997-10197019 CACTCACAGCTGCCACGCACGGG + Intergenic