ID: 902486346

View in Genome Browser
Species Human (GRCh38)
Location 1:16749154-16749176
Sequence CAGCTGTCCCTCCACCAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 3, 1: 0, 2: 4, 3: 85, 4: 502}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902486341_902486346 2 Left 902486341 1:16749129-16749151 CCCGGACGCAGCGGCCTGCAGGG 0: 2
1: 1
2: 4
3: 20
4: 423
Right 902486346 1:16749154-16749176 CAGCTGTCCCTCCACCAGCCGGG 0: 3
1: 0
2: 4
3: 85
4: 502
902486338_902486346 12 Left 902486338 1:16749119-16749141 CCGGGGTCTGCCCGGACGCAGCG 0: 2
1: 1
2: 0
3: 7
4: 92
Right 902486346 1:16749154-16749176 CAGCTGTCCCTCCACCAGCCGGG 0: 3
1: 0
2: 4
3: 85
4: 502
902486343_902486346 1 Left 902486343 1:16749130-16749152 CCGGACGCAGCGGCCTGCAGGGC 0: 2
1: 0
2: 1
3: 11
4: 314
Right 902486346 1:16749154-16749176 CAGCTGTCCCTCCACCAGCCGGG 0: 3
1: 0
2: 4
3: 85
4: 502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902486346 Original CRISPR CAGCTGTCCCTCCACCAGCC GGG Intronic
900762401 1:4481990-4482012 CCTCTGTCCCTCCACCAGAGTGG - Intergenic
900764650 1:4495859-4495881 CAGCTCTCCCTCCCCCAGTTGGG - Intergenic
901130311 1:6958414-6958436 CAGCTGCCTCTCCGCCAGGCTGG - Intronic
901780287 1:11589785-11589807 AAGCTGACCCACCTCCAGCCTGG - Intergenic
902451351 1:16498885-16498907 CAGCCGTCCCTCCGCCGGTCGGG - Intergenic
902472458 1:16658292-16658314 CAGCTGTCCCTCCACCAGCCGGG - Intergenic
902486346 1:16749154-16749176 CAGCTGTCCCTCCACCAGCCGGG + Intronic
902501518 1:16914397-16914419 CAGCCGTCCCTCCGCCGGCCGGG + Intronic
902714842 1:18265601-18265623 CACCTGCCCCTACACCAGTCCGG + Intronic
903666865 1:25013427-25013449 CTGCTGTCCTGACACCAGCCTGG + Intergenic
903947712 1:26974007-26974029 CTGCTGTCCCCCCACCACCCAGG - Intergenic
904446444 1:30576796-30576818 CAGCAGCCCCTGCCCCAGCCTGG + Intergenic
904771751 1:32884892-32884914 CAGCTGTCCCCACCCCACCCCGG + Intergenic
904916163 1:33972070-33972092 CCGCGGTCCCTGCCCCAGCCTGG - Intronic
905172006 1:36115089-36115111 CAGCTGGCCCTTCCCCACCCAGG + Intronic
905278339 1:36833459-36833481 CAGCCCTCCCCCGACCAGCCAGG - Intronic
905455944 1:38087896-38087918 CAGCACTCTCTCCACCTGCCTGG - Intergenic
905484238 1:38284386-38284408 CAGCTGCCCCAGCACCAGCCCGG + Intergenic
906242467 1:44250488-44250510 CAGCTTTCCCTGGTCCAGCCTGG - Intronic
906344646 1:45007555-45007577 CTGCTGTCCCGCCAGCGGCCAGG - Exonic
906361382 1:45162760-45162782 CGGGTGCCCCTCCCCCAGCCTGG - Intronic
906394661 1:45451537-45451559 GAGCTGCCCCTTCACCACCCCGG - Intronic
906752446 1:48277615-48277637 CGGGTGCCCCTCCCCCAGCCTGG - Intergenic
906760132 1:48369481-48369503 TAGGTGCCCCTCCCCCAGCCTGG + Intronic
906980500 1:50623491-50623513 CAACTTGCCCTCCACCTGCCGGG - Intronic
907309436 1:53530860-53530882 CATCTGTCCCTGTCCCAGCCAGG + Intronic
907443065 1:54490260-54490282 CCCCTGCCCCGCCACCAGCCTGG - Intergenic
907510016 1:54951000-54951022 CAACTATCCCTCCCGCAGCCTGG + Intergenic
908898114 1:68923912-68923934 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
909657345 1:78046144-78046166 CGGCTCGCCCTCCACCAGCCCGG - Exonic
909668156 1:78159114-78159136 CGGATGCCCCTCCCCCAGCCAGG - Intergenic
910311600 1:85830502-85830524 CGGGTGCCCCTCCCCCAGCCTGG + Intronic
910318889 1:85921370-85921392 CAGATGCCCCTCCCCCTGCCAGG - Intronic
910956878 1:92715896-92715918 TGGATGTCCCTCCACCTGCCAGG - Intronic
911339265 1:96617570-96617592 CAGACGCCCCTCCCCCAGCCAGG + Intergenic
911399580 1:97358237-97358259 CAGATGCCCCTCCACCTGCCAGG - Intronic
911700771 1:100949720-100949742 CAGATGCCCCTCCCCCAGCCAGG + Intronic
912703973 1:111898370-111898392 CACCTGTACCTCCACATGCCTGG + Intronic
912886361 1:113478957-113478979 CAGATGCCCCTCCCCCAGCCAGG + Intronic
914918404 1:151831865-151831887 CACCTGGCCCTCCAGCAGGCAGG + Exonic
915342988 1:155186339-155186361 CACCTGCCACCCCACCAGCCAGG + Intronic
917975165 1:180233546-180233568 CAGCAGTCCCTCCACGCGTCGGG + Intronic
918003895 1:180524080-180524102 TAACAGTCCCTCCTCCAGCCAGG - Intergenic
918159314 1:181882645-181882667 CAGATGCCCCTCCCCCTGCCAGG - Intergenic
918826494 1:189330981-189331003 CAGGCGCCCCTCCCCCAGCCTGG + Intergenic
919931202 1:202222458-202222480 CAGCTGTCCCCCCAGGGGCCGGG - Intronic
920232246 1:204478331-204478353 CAACTGCCCCTCCCACAGCCCGG + Intronic
920588822 1:207196371-207196393 CAGACGCCCCTCCCCCAGCCAGG - Intergenic
922116413 1:222618160-222618182 CAGCTGGCCCGGCACCCGCCAGG - Exonic
922572828 1:226644003-226644025 CAGGAGTCCCTCCCACAGCCTGG - Intronic
922870440 1:228898135-228898157 CAGATGTGGCTCCACCAGGCCGG + Intergenic
924404799 1:243731100-243731122 CAGGTGTCACTCTGCCAGCCGGG - Intronic
1063067578 10:2624533-2624555 CAGCGGCCACTGCACCAGCCTGG - Intergenic
1063286473 10:4694097-4694119 AAGCTGGCCATCCATCAGCCAGG + Intergenic
1063320265 10:5045750-5045772 CTGCAGTCCGTGCACCAGCCTGG - Intronic
1063320272 10:5045783-5045805 CTGCAGTCCATGCACCAGCCTGG - Intronic
1063332995 10:5180691-5180713 CGGGTGCCCCTCCCCCAGCCTGG + Intergenic
1063978374 10:11434850-11434872 CAGCTCCCACTCCACCAGACAGG + Intergenic
1064922180 10:20531397-20531419 CGGGTGCCCCTCCCCCAGCCTGG + Intergenic
1066321663 10:34308912-34308934 CAGCTTTCCCTCCTCCTCCCTGG - Intronic
1067127601 10:43533189-43533211 CAGACGCCCCTCCCCCAGCCAGG + Intergenic
1067713626 10:48670793-48670815 CACCTTCCCCTCCACCAGCGGGG + Intergenic
1068770746 10:60818084-60818106 CCACTGTCCCTCAACAAGCCAGG - Intergenic
1069273723 10:66563999-66564021 AAGCTGTACCTCCACCACCTTGG + Intronic
1070003095 10:72395716-72395738 CAGATGCCCCTCCCCCAGCCAGG - Intronic
1071421502 10:85504778-85504800 CAGACGCCCCTCCCCCAGCCAGG + Intergenic
1071838583 10:89445034-89445056 CAGATGCCCCTCCCGCAGCCGGG - Intronic
1072683175 10:97521272-97521294 AAGCGTGCCCTCCACCAGCCAGG - Intronic
1073927370 10:108532874-108532896 CAGATGCCCCTCCCCCAGCCAGG - Intergenic
1074424157 10:113336383-113336405 AACCTGTTCCTCCACCTGCCTGG - Intergenic
1075057868 10:119233415-119233437 CAAGTTTCCCTCCACCAGCTTGG - Intronic
1075275616 10:121090007-121090029 CACCTCAACCTCCACCAGCCAGG + Intergenic
1075658273 10:124175809-124175831 CAGCCTCCCCTCCCCCAGCCTGG + Intergenic
1076131399 10:128016530-128016552 GAGCTGTCTCCTCACCAGCCTGG - Intronic
1076550290 10:131273576-131273598 CAGCTTTCCCGCCTCCATCCAGG + Intronic
1076580908 10:131510269-131510291 CAGGTGCCCCTCCCCCAGCCTGG + Intergenic
1076990617 11:271453-271475 GGGGTGTCCCTTCACCAGCCGGG - Intergenic
1077161000 11:1112870-1112892 CAGCAGTCCCTGCACAGGCCAGG + Intergenic
1077161526 11:1114886-1114908 CTGCTGTACCACCACCAGGCAGG + Intergenic
1077213012 11:1382202-1382224 CTCCTGTCCCTGCCCCAGCCCGG - Intergenic
1077241134 11:1510646-1510668 CAGCTGTCCCCCAGCAAGCCTGG - Intergenic
1077280967 11:1745255-1745277 AAGCTGTCCCTCCTCCCGCTTGG - Intronic
1077324579 11:1958264-1958286 CAGCCTCCCCTCCCCCAGCCCGG + Intronic
1077662621 11:4083071-4083093 GAGCTGTCCCTCCACCAATGAGG - Intronic
1077723248 11:4648004-4648026 CAACAGTCCCTCCACGAGACAGG - Intronic
1077788551 11:5412727-5412749 CGGGTGCCCCTCCCCCAGCCTGG - Intronic
1077895268 11:6448989-6449011 TGTCTGTCCCTCCACAAGCCAGG + Exonic
1078283841 11:9931039-9931061 CAGATGCCCCTCCCCCAGCCAGG - Intronic
1078454252 11:11462836-11462858 CAGTGCTCCCTCCACCACCCGGG + Intronic
1078695643 11:13628805-13628827 CAGGTGCCCCTCCTCCAGCCTGG + Intergenic
1079037553 11:17034207-17034229 CGGGTGCCCCTCCCCCAGCCTGG + Intergenic
1079957488 11:26882605-26882627 CAGATGCCCCTCCCCCAGCCAGG - Intergenic
1080641274 11:34159947-34159969 CAGCTTTCCTTCCACCAGGAAGG + Exonic
1081628558 11:44671489-44671511 CAGCTGCTCCAGCACCAGCCAGG + Intergenic
1081674491 11:44960569-44960591 AATCTCTCCCTCCCCCAGCCTGG + Intergenic
1081749632 11:45500727-45500749 CAAGGGTCCCTCCACCAGCCAGG + Intergenic
1081793129 11:45803094-45803116 CAGCTGCCCCACAACGAGCCGGG - Intergenic
1081958920 11:47119164-47119186 CAGATGCCCCTCCCCCAGCCAGG + Intronic
1082113894 11:48306990-48307012 CATTCGTCCCTCCACCACCCTGG + Exonic
1082253278 11:50005413-50005435 CAGGTGCCCCTCCCCCAGCCTGG - Intergenic
1083274394 11:61588455-61588477 CACCTGTCCCTCCACCCTGCCGG - Intergenic
1083431644 11:62616456-62616478 CACCTGTCCATCCAAGAGCCAGG + Intronic
1084175148 11:67419011-67419033 CAGCCGGTCCTCCAGCAGCCGGG - Exonic
1084213365 11:67634025-67634047 CTGCTGTGCCACCCCCAGCCAGG + Intronic
1084420787 11:69059490-69059512 GGGCTGTCTCTCCCCCAGCCAGG - Intronic
1084495948 11:69503589-69503611 CAGCTGACCCTCAAACAGCCCGG + Intergenic
1084660015 11:70541274-70541296 CACCTGTCCTTCCGTCAGCCTGG + Intronic
1085525805 11:77162831-77162853 CAGCTGCCCCTCCACTCCCCAGG + Exonic
1086494372 11:87386931-87386953 CAGAAGCCCCTCCCCCAGCCAGG - Intergenic
1086506283 11:87507956-87507978 CAGATGCCCCTCCCCCAGTCAGG + Intergenic
1087216615 11:95502013-95502035 CTGGAGTCCCTCCACCAGCACGG - Intergenic
1087311161 11:96545418-96545440 CAGACGCCCCTCCCCCAGCCAGG - Intergenic
1087780928 11:102301069-102301091 CAGATGCCCCTCCCCCAGCCAGG + Intergenic
1088656671 11:112006221-112006243 CAGGTGCCCCTCCCCCTGCCAGG - Intronic
1088811797 11:113397316-113397338 AAGCTGTCGCTGCGCCAGCCCGG + Exonic
1088916102 11:114228919-114228941 CAGCTGTCCCTCCCCTTCCCTGG + Intronic
1089111511 11:116061594-116061616 CAGCTAACCCCCCTCCAGCCTGG - Intergenic
1089663483 11:120001289-120001311 CAGCCTTCCCACCACCACCCGGG - Intergenic
1090249685 11:125242555-125242577 CTGATGTCCCCCCACCAGCTGGG - Intronic
1202807558 11_KI270721v1_random:13441-13463 CAGCCTCCCCTCCCCCAGCCCGG + Intergenic
1091487150 12:900517-900539 CAGCAGACCCTCCACCCTCCTGG + Exonic
1091667809 12:2431784-2431806 CAGCTGTACCTCCACCTGCTTGG - Intronic
1093412945 12:18888223-18888245 CAGCTGTGTCTCCACCCACCGGG - Intergenic
1093597681 12:20981438-20981460 CAGATGCCCCTCCCCCATCCAGG + Intergenic
1093882570 12:24422420-24422442 CAGCCGTCTCTTCCCCAGCCTGG + Intergenic
1094135393 12:27120010-27120032 CAGACGCCCCTCCCCCAGCCAGG + Intergenic
1097234320 12:57529161-57529183 CAGCTGTCCCTCTGCCTCCCCGG + Exonic
1097915695 12:65018395-65018417 CAGGTGTCCCTACAGGAGCCCGG - Intergenic
1099106780 12:78506856-78506878 CGGGCGTCCCTCCCCCAGCCTGG - Intergenic
1099235700 12:80080380-80080402 CGGGTGCCCCTCCCCCAGCCTGG + Intergenic
1100381361 12:94064684-94064706 CAGACGCCCCTCCCCCAGCCAGG - Intergenic
1100571781 12:95849742-95849764 CAGTAGTCCCTCCCCCACCCAGG - Intergenic
1100823671 12:98455246-98455268 CCGCTGTGTCTCCACCAGGCGGG + Intergenic
1101074750 12:101117118-101117140 CAGCTGTCGCTCAACCCGCCTGG - Intronic
1102039176 12:109789627-109789649 AACCTGTCCCTAAACCAGCCAGG + Intronic
1102099491 12:110267451-110267473 CAGCTGTCCCTTCCCCACCCTGG + Intergenic
1102257538 12:111424974-111424996 CAGCAGGGCCTCCACCAGGCTGG - Intronic
1102754536 12:115326822-115326844 CAGCTGTACCCCAACCAGCTGGG - Intergenic
1103050886 12:117778635-117778657 CAGCTGTGCCTCCACCAGCTGGG + Intronic
1103593680 12:122010081-122010103 CGGCTGTCCCTGCACCCGCGAGG + Intergenic
1103700388 12:122846125-122846147 CAGCTGTCCTGTCACAAGCCAGG - Intronic
1104125821 12:125844992-125845014 CAGCTCCACCTCCTCCAGCCAGG - Intergenic
1104734931 12:131130848-131130870 CTGCTGTCCCCACGCCAGCCTGG - Intronic
1104912379 12:132245543-132245565 CTGCTGACCCTCGCCCAGCCAGG + Intronic
1104912401 12:132245603-132245625 CTGCTGACCCTCGCCCAGCCAGG + Intronic
1104972520 12:132538378-132538400 CAGCTGTCTCTTCACGGGCCTGG + Intronic
1105748243 13:23397835-23397857 AAGCTGTACCTCAACCACCCTGG - Intronic
1105889530 13:24672593-24672615 CAGTTTTACCTCCTCCAGCCAGG + Intergenic
1106136963 13:26980747-26980769 CATCTGTCCCTGCATCAACCTGG + Intergenic
1106507359 13:30382899-30382921 CAGATGGCCCTCAACCAGACTGG - Intergenic
1108213151 13:48158507-48158529 CAGCTGTCACTCCAGCTTCCTGG - Intergenic
1108239256 13:48445070-48445092 GAGCTGTGCCTACACCCGCCTGG + Intronic
1108988774 13:56629104-56629126 CAGACGCCCCTCCCCCAGCCAGG - Intergenic
1109385915 13:61629026-61629048 CAGACGACCCTCCCCCAGCCAGG + Intergenic
1109963892 13:69667159-69667181 CAGATGCCCATCCCCCAGCCAGG - Intergenic
1110818553 13:79887464-79887486 CAGACGCCCCTCCCCCAGCCAGG - Intergenic
1112288457 13:98124481-98124503 CAGCTGTTCCTCAACCACACTGG + Intergenic
1113736878 13:112685466-112685488 CATCTCTCCCTACACCTGCCTGG - Intergenic
1113855841 13:113445058-113445080 CAGCTGTCCCTGCAGCACCTGGG - Intronic
1114171846 14:20280472-20280494 CAGGCGCCCCTCCCCCAGCCTGG - Intronic
1114417664 14:22555136-22555158 CAGCTGCAGCTCTACCAGCCTGG + Intergenic
1115271841 14:31561484-31561506 CAGTGGCCCCGCCACCAGCCCGG - Exonic
1115294649 14:31812349-31812371 CAGACGCCCCTCCCCCAGCCAGG + Intronic
1115774378 14:36699656-36699678 TGGATGTCCCTCCCCCAGCCAGG + Intronic
1116570398 14:46508984-46509006 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
1117170044 14:53085058-53085080 CAGATGCCCCTTCCCCAGCCAGG - Intronic
1117193721 14:53318467-53318489 CAGATGCCCCTCCCCCAGCCTGG - Intergenic
1118930230 14:70234396-70234418 CTGCTGCCCCACCACCCGCCAGG + Intergenic
1119556554 14:75557882-75557904 CAGCTGTGGCTCAAGCAGCCTGG - Intergenic
1119930559 14:78542396-78542418 CAGATGCCCCTCCCCCAGCCAGG + Intronic
1120136667 14:80878095-80878117 CAGCAGCCCCTCCCCCAGCAGGG + Intronic
1120965804 14:90166762-90166784 CAGCTCTCCTTCCACAGGCCAGG - Intronic
1121017034 14:90555222-90555244 CAGCACTCCCTACACCAACCTGG + Intronic
1121082570 14:91120196-91120218 CAGCTCTCCCTCCTCCGGGCAGG + Intronic
1121625686 14:95384109-95384131 CAGCTGTACCTACACCACCCTGG - Intergenic
1122430719 14:101639592-101639614 GAGCTGTCCTTCCACCATTCGGG + Intergenic
1122548042 14:102535571-102535593 CAGCACTCCCTCCACAGGCCTGG - Intergenic
1122812203 14:104294645-104294667 CAGATGTCCCTCCCCCATGCGGG + Intergenic
1202883328 14_KI270722v1_random:82092-82114 CGGGTGCCCCTCCCCCAGCCTGG + Intergenic
1124393504 15:29280712-29280734 CAGCTTTGCTTCCAGCAGCCGGG + Intronic
1124637100 15:31372263-31372285 CAGCAGCCCCACCATCAGCCCGG + Exonic
1125579653 15:40776245-40776267 CTGCTGTTCCTCCAGCTGCCGGG + Exonic
1126001378 15:44213256-44213278 CAGCTGTTTCTCCAGCTGCCTGG + Intergenic
1126845146 15:52752788-52752810 CACCTGTCCCTCCACCAGGCAGG - Intergenic
1126922256 15:53541054-53541076 CGGGCGTCCCTCCCCCAGCCTGG - Intronic
1127607873 15:60608065-60608087 CTGCTGCCTCTCCACCTGCCAGG + Intronic
1128501247 15:68229179-68229201 CGGCTGTCCCGGCGCCAGCCCGG + Intronic
1129034695 15:72642066-72642088 CTGCTGGCCCTTCCCCAGCCTGG + Intergenic
1129215187 15:74095150-74095172 CTGCTGGCCCTTCCCCAGCCTGG - Intergenic
1129390137 15:75216195-75216217 CTGCTGGCCCTTCCCCAGCCTGG + Intergenic
1129732331 15:77939495-77939517 CTGCTGGCCCTTCCCCAGCCTGG - Intergenic
1130053229 15:80501607-80501629 CGTCTCTCCCTCCAGCAGCCAGG + Intronic
1130064248 15:80591663-80591685 CAGCACTCCCACCAGCAGCCCGG + Exonic
1130527703 15:84721516-84721538 CAGCTGTCCCTGCAGCTGTCTGG - Intergenic
1130540321 15:84817277-84817299 CTGCTGTCCCTCCCCTGGCCTGG - Exonic
1130992877 15:88887073-88887095 CTGCTGTCCCTGTCCCAGCCTGG + Intronic
1131114080 15:89783612-89783634 GCTCTGTCCCTCCACCAGCCAGG - Intergenic
1132221920 15:100111364-100111386 CAGCTGTCCTTCCACTTGCAGGG + Intronic
1132568232 16:632893-632915 CAGCTGGCCGCCCAGCAGCCCGG + Exonic
1133241409 16:4416391-4416413 CGGCTGCCCCTCCCCCTGCCCGG - Intronic
1133570137 16:7032924-7032946 AAGCTGTTCTCCCACCAGCCAGG - Intronic
1133708569 16:8379153-8379175 AAGCTGTCCTTCTTCCAGCCAGG - Intergenic
1134013231 16:10870600-10870622 CAGCTGTCCAGCCTCCAGCCTGG - Intergenic
1134070415 16:11256576-11256598 CAGCTGTCTCCACACCCGCCGGG + Intronic
1134250762 16:12572336-12572358 CTGCTGTCCATCAACCAGGCAGG - Exonic
1134859794 16:17551012-17551034 AAGCTGTGCCCCGACCAGCCTGG + Intergenic
1134860796 16:17558653-17558675 TGGCTTTCCCTCCACCAACCAGG + Intergenic
1136010208 16:27358687-27358709 CAGCTGTCACTCCACCTCCTTGG + Intronic
1136271503 16:29151561-29151583 AAACTGTTCCTCCCCCAGCCGGG - Intergenic
1136279497 16:29199677-29199699 CCGCTTTCCCTGCCCCAGCCCGG + Intergenic
1136494864 16:30636479-30636501 CAATTGTGCCACCACCAGCCTGG - Intergenic
1137370995 16:47905711-47905733 CAGCTCTGCCTCCACCTACCAGG - Intergenic
1137890948 16:52161484-52161506 CAGATGCCCCTCCCCCAGCCAGG + Intergenic
1139429501 16:66903668-66903690 CAGCTGCCTCTCCCACAGCCAGG - Intergenic
1139548167 16:67659490-67659512 CAGCTCTCCCCACCCCAGCCTGG - Intronic
1139574646 16:67833353-67833375 CAGCTTTCCCCAGACCAGCCAGG - Intronic
1140328666 16:74030551-74030573 CAGCCTTCCCTCCCCCACCCTGG - Intergenic
1140525396 16:75618713-75618735 CAGCAGTCCCACCAGCACCCAGG + Intronic
1141029242 16:80573470-80573492 CAGCTGGCTCTCCCCCAGCAGGG - Intergenic
1141151958 16:81570497-81570519 TAGCGGTCCCACCACCTGCCAGG - Intronic
1142083888 16:88165778-88165800 CCGCTTTCCCTGCCCCAGCCCGG + Intergenic
1142128453 16:88421521-88421543 CAGCTGTCCCTCCAGGGGCTCGG - Intergenic
1142490325 17:274350-274372 CTGCTGCCCCTACTCCAGCCAGG - Intronic
1142697888 17:1643664-1643686 CAGCGGCGCCCCCACCAGCCCGG + Exonic
1143156984 17:4843865-4843887 CAGGTCTCCCTCCAACAGCATGG - Intronic
1143377513 17:6475686-6475708 CATCTGTCCCTACACCAGAGGGG + Intronic
1143731130 17:8883471-8883493 CAGCTGTCTCTGCTCCAGCCTGG + Intronic
1144848275 17:18231261-18231283 AAGCTGCCCCTCCCCCTGCCAGG + Intronic
1144854976 17:18262647-18262669 CAGCAGCCCCTCTCCCAGCCTGG + Intronic
1145996918 17:29110197-29110219 CAGCGGCCCCAGCACCAGCCAGG + Intronic
1147982424 17:44282724-44282746 CAGCTGTCCCTCTGAGAGCCTGG + Intergenic
1148083237 17:44978950-44978972 CAGGTGTCTGACCACCAGCCTGG + Intergenic
1148085480 17:44991258-44991280 CATCTGTCCCTCCAACCGCTCGG - Intergenic
1148461219 17:47840099-47840121 CATCCATCCCTCCCCCAGCCTGG - Intronic
1149442669 17:56688339-56688361 CAGCTGTCCCTACAGCAGAGTGG + Intergenic
1149553258 17:57555487-57555509 CAGCAGCTCCTCAACCAGCCAGG + Intronic
1149581141 17:57751092-57751114 AAGCTGGCCCTTCTCCAGCCTGG + Intergenic
1149932046 17:60766905-60766927 CGGATGCCCCTCCCCCAGCCAGG + Intronic
1150302186 17:64055842-64055864 CAGCTGCCCTTCCACCCACCTGG - Exonic
1151716613 17:75834412-75834434 CAGCTGCCCCTGCTCCAGCACGG + Exonic
1152032434 17:77852807-77852829 CCTCTCTGCCTCCACCAGCCGGG - Intergenic
1152152665 17:78612277-78612299 CAGAGGTCCCTCCTCCACCCGGG - Intergenic
1152277794 17:79368300-79368322 GACCTCCCCCTCCACCAGCCTGG + Intronic
1152430725 17:80246969-80246991 CTCCTGTCCCTCCCCCAGCTGGG - Intronic
1152639875 17:81444965-81444987 GAGCTGTCCCCTCCCCAGCCAGG + Intronic
1152680270 17:81664272-81664294 CGGGTGCCCTTCCACCAGCCTGG - Intergenic
1154065353 18:11102453-11102475 CACCTGCCACTGCACCAGCCTGG - Intronic
1154387684 18:13910633-13910655 CAGCTGTCTCTCCTCCAGGCAGG - Intronic
1155562468 18:27093453-27093475 CAGATGCCCCTTCCCCAGCCAGG + Intronic
1155654643 18:28178208-28178230 CCGCAGCCCCTCCACCTGCCGGG - Intergenic
1156453015 18:37277270-37277292 CAGCTGGCCCTCCAACAGGGTGG + Intronic
1156465974 18:37348036-37348058 CAACTGACCCTCCTCCAGGCCGG + Intronic
1156852570 18:41745398-41745420 ATGCTTTCCCTCCACCAGCCTGG - Intergenic
1159040271 18:63318365-63318387 CACCTGACCCTCCGCCAGGCCGG - Exonic
1159498232 18:69233825-69233847 CAGCTGTCCCTCTCACAGTCAGG + Intergenic
1159941303 18:74410987-74411009 GAGCTCTGCCTCCACCTGCCTGG - Intergenic
1160186439 18:76680005-76680027 GAGCTGTCCCTGCACCTGCCTGG + Intergenic
1160239375 18:77112268-77112290 CAGCTTTGCCGCCACCCGCCTGG - Intronic
1160296001 18:77637526-77637548 CAGATGTCCCTCCCCAAGCCAGG - Intergenic
1160909430 19:1467968-1467990 CAGCTGCCCCGCCGCCCGCCCGG + Exonic
1161028146 19:2046084-2046106 CGGCTGTCCGTCCTACAGCCGGG - Intronic
1161221598 19:3120471-3120493 CCCCTGCCCCTCCACCACCCTGG - Intronic
1161297291 19:3526460-3526482 CAGCTCTGCCTCCCCGAGCCCGG + Intronic
1161317783 19:3626379-3626401 GGGCTGTCCCTCCAACCGCCCGG + Intronic
1161979751 19:7624262-7624284 CAGCTCTCTCCCCACCAGCCGGG + Intronic
1163395635 19:17059098-17059120 CTGCTGTCTCTCCACCTGCCAGG - Intronic
1163670120 19:18622713-18622735 CCACTGTCACTCCATCAGCCTGG - Intergenic
1163677228 19:18661142-18661164 CAGCAGTCACTCAACCACCCAGG - Intronic
1163732671 19:18958917-18958939 CAGCGGTCCCTCCCTCAGACAGG - Intergenic
1164466223 19:28489609-28489631 GAGCAGTCCCTCTTCCAGCCAGG + Intergenic
1164522739 19:28991250-28991272 GAGCTGTCCTGCCACCACCCAGG - Intergenic
1164619413 19:29685463-29685485 CAGCTGTTCCTCCAGCATTCAGG + Intergenic
1164623498 19:29711867-29711889 CAGCTCTACCTGCTCCAGCCAGG + Intronic
1164841607 19:31397323-31397345 CAGCTGCCCATCCTACAGCCTGG - Intergenic
1164933197 19:32191133-32191155 CCTCTGTCCATTCACCAGCCTGG + Intergenic
1165649815 19:37476393-37476415 CAGCTCTCTCTTCACCATCCAGG - Exonic
1168460394 19:56550564-56550586 CAGCTCTCGCTTCACCATCCAGG - Exonic
1202658740 1_KI270708v1_random:49236-49258 CGGGTGCCCCTCCCCCAGCCTGG + Intergenic
1202704853 1_KI270713v1_random:15114-15136 CAGCTGTCCCTCCACCAGCCGGG - Intergenic
925921413 2:8640586-8640608 CTGCTGTCCCTCACCCAGCCTGG + Intergenic
927283894 2:21336364-21336386 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
927297171 2:21468103-21468125 CAGCTGTCCTCCCAACAGACAGG + Intergenic
927662321 2:25003351-25003373 CAGCTGTCTCAGCACCAGTCAGG - Intergenic
927720188 2:25377418-25377440 CAGACGTCACTCCACCCGCCAGG - Exonic
927939288 2:27093674-27093696 CAGCAGTCCAGCCACCATCCTGG - Intronic
928404574 2:31004757-31004779 CAGCTCTCCCTCCAAAAGCCAGG + Intronic
928719333 2:34101054-34101076 CAGCTATCACTCCAAAAGCCAGG - Intergenic
928765042 2:34635733-34635755 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
928920307 2:36520114-36520136 CAGGTTTCCTTCCACCAGGCAGG - Intronic
929025733 2:37599899-37599921 CAGACGTCCCTTCCCCAGCCAGG + Intergenic
929318583 2:40512163-40512185 CAGCTCTGCCTCCACAAGACAGG - Intronic
930972929 2:57419132-57419154 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
930987596 2:57609261-57609283 CGGGTGCCCCTCCCCCAGCCTGG - Intergenic
931195436 2:60048222-60048244 CAGATGTCCCTGCAACAGCTGGG + Intergenic
932135234 2:69223073-69223095 GAGCTGGCTCTCCTCCAGCCTGG + Intronic
932865448 2:75336633-75336655 CAGCTGTCCAGCCTCCAGCTGGG - Intergenic
932887846 2:75562991-75563013 CAGGTGTCCTTTCTCCAGCCTGG - Intronic
933271978 2:80242765-80242787 GAGCTGTTCCTCTGCCAGCCTGG + Intronic
933579012 2:84104046-84104068 CAGGCGCCCCTCCCCCAGCCTGG + Intergenic
934052694 2:88223632-88223654 CAGCTGTTTCTCCCACAGCCAGG - Intergenic
935347423 2:102121430-102121452 AGGCTGCTCCTCCACCAGCCCGG + Intronic
936947911 2:117947218-117947240 CAGCTGTCCATCTTCCAGCCTGG + Intronic
937347293 2:121133894-121133916 CATCTGTCCATCCACCCACCTGG + Intergenic
938017522 2:127879778-127879800 CACCTGGTCCTCCAGCAGCCCGG + Intronic
938250842 2:129814357-129814379 AAGCTGTACCCCCACCACCCTGG - Intergenic
938320070 2:130356482-130356504 CACCTGTCCCGCCCGCAGCCAGG - Intronic
939074881 2:137588034-137588056 CAGGTGCCCCTCCCCCAGCCTGG + Intronic
939604805 2:144240844-144240866 CAGCTGACCCTGCACCCTCCTGG - Intronic
939730845 2:145782798-145782820 CAGATGCCCCTCCCCCAGCCAGG - Intergenic
940055286 2:149506959-149506981 CAGGCGCCCCTCCCCCAGCCTGG + Intergenic
940995847 2:160148884-160148906 CAGATGCCCCTTCCCCAGCCAGG - Intronic
943233619 2:185290254-185290276 CAGACGCCCCTCCCCCAGCCAGG - Intergenic
944070014 2:195657635-195657657 CAGCGGTCACTCCCCCACCCCGG - Intronic
944210507 2:197202031-197202053 TAGCTGCCCCTCCTCCACCCAGG + Intronic
944665993 2:201960270-201960292 TGGCTGTCACTCCACCTGCCTGG + Intergenic
946427767 2:219608497-219608519 GAACTGGCCCTCCACCCGCCAGG - Intronic
947582567 2:231330656-231330678 CAGCTGTACCCTCACCAGGCTGG - Intronic
948179230 2:235966534-235966556 CAACTTTCCCTCTACCAGGCAGG - Intronic
948534598 2:238636529-238636551 CAGGTGTCCCTACTGCAGCCTGG - Intergenic
948888023 2:240893520-240893542 CAGCTGCAACTGCACCAGCCCGG + Intronic
1168873735 20:1154840-1154862 CAGCTGGCACTCCAGAAGCCTGG + Intronic
1168928196 20:1599795-1599817 CAGGGGTCCCTCTACTAGCCTGG - Intronic
1169012841 20:2264852-2264874 CAGACGCCCCTCCCCCAGCCAGG - Intergenic
1169307084 20:4501539-4501561 CGGATGCCCCTCCCCCAGCCAGG + Intergenic
1171247177 20:23621041-23621063 CAGATGCCCCTCCCCCTGCCAGG + Intergenic
1172448107 20:35003586-35003608 CAGCTGCCTCAACACCAGCCTGG - Exonic
1173476321 20:43362338-43362360 TATCTGTCTCCCCACCAGCCTGG - Intergenic
1174173482 20:48630952-48630974 CACCTGTTCCTACAACAGCCGGG + Intronic
1175071401 20:56336881-56336903 CGGATGCCCCTCCCCCAGCCAGG - Intergenic
1175208014 20:57326856-57326878 CAGCTCACCCTCCAGCAGCTAGG - Intergenic
1175494614 20:59404932-59404954 CACCTGCCCATCCACCATCCCGG + Intergenic
1175527377 20:59644727-59644749 GGGCTCTCCCTGCACCAGCCTGG + Intronic
1175991020 20:62789170-62789192 CAGCTGTCCTTTCTCCTGCCTGG - Intergenic
1176254727 20:64145985-64146007 CATCTGTTCCCCCACCAGCCAGG - Intergenic
1176307765 21:5133136-5133158 CAGCAATCCCTCCAAGAGCCTGG + Intronic
1178588673 21:33891108-33891130 ATGCTGTCCATCCACCTGCCAGG - Exonic
1178632928 21:34278262-34278284 AGCCTGTCCCTGCACCAGCCTGG + Intergenic
1178785814 21:35652211-35652233 TAGCTTCCCCTCCACAAGCCTGG + Intronic
1178810811 21:35879326-35879348 CAGACGTCCCTCTCCCAGCCAGG + Intronic
1179216062 21:39368138-39368160 CAGGTGCCCATCAACCAGCCCGG + Intergenic
1179831609 21:44000545-44000567 CTGCTGTCCCTGCACCAGCCTGG + Intergenic
1179894857 21:44355821-44355843 CAGCTGTCCCTCCGCATCCCTGG + Intronic
1179967333 21:44815167-44815189 CAGTTGTCCCTCTCCCAGCCAGG - Intronic
1180064085 21:45404425-45404447 CAGCTGTGCCCCCACCCGACCGG - Intergenic
1180326208 22:11432755-11432777 CGGGTGCCCCTCCCCCAGCCTGG + Intergenic
1181448689 22:23000990-23001012 CAGCTGTCCCATCACATGCCTGG - Intergenic
1181747506 22:24966126-24966148 CAGCTGTTTCTCCAACAGGCAGG - Intronic
1183271820 22:36867044-36867066 CAGCTGTACCCCCATCACCCAGG - Intronic
1183405239 22:37627315-37627337 CAGCTCTCCCTCCACACTCCGGG - Intronic
1183505885 22:38208677-38208699 TTGCTGTCTCTCCACCAGACAGG - Intronic
1183520785 22:38295079-38295101 GAGCTGTCCTTCCCCCTGCCGGG + Intronic
1183710149 22:39498610-39498632 CCTCTGTTCCTCCATCAGCCTGG + Intergenic
1183744753 22:39685997-39686019 CAGCGGGGGCTCCACCAGCCCGG + Exonic
1184473100 22:44707025-44707047 TATCTGTCACCCCACCAGCCTGG - Intronic
1184685885 22:46096135-46096157 CACCTCTCCCACCAGCAGCCTGG - Intronic
1185275673 22:49949363-49949385 GAGCTGTCCCTGCTGCAGCCTGG - Intergenic
949245246 3:1919213-1919235 CAGATGACCCTCCCCCAGCCAGG + Intergenic
949412227 3:3778412-3778434 CACCACTCCCTCCACCAGCAGGG - Intronic
949450039 3:4174969-4174991 CAGACGCCCCTCCCCCAGCCCGG - Intronic
949702681 3:6777179-6777201 GAGGGCTCCCTCCACCAGCCAGG + Intronic
950425933 3:12924773-12924795 CAGCTGCCCGGCCACCAGCCAGG + Intronic
950448014 3:13049190-13049212 CAGCCCTCCATCCCCCAGCCTGG + Intronic
950572696 3:13811797-13811819 CTGCAGTCCCTGCACCTGCCTGG - Intergenic
952542016 3:34376796-34376818 CAGCTGACCTACCACCACCCTGG - Intergenic
952612325 3:35226241-35226263 CAGGTGCCCCTCCCCCAGCCTGG - Intergenic
952888962 3:38028788-38028810 TCGCTGTCCCTCCAGCAGCGAGG - Intronic
952936909 3:38405820-38405842 CAGGCGCCCCTCCCCCAGCCTGG - Intronic
953922573 3:46962688-46962710 CCACTATACCTCCACCAGCCTGG + Intronic
954407167 3:50351645-50351667 CAGAATTCCCTCAACCAGCCAGG - Intronic
954811968 3:53254285-53254307 CAGCTCCCCTTTCACCAGCCTGG - Intronic
954836492 3:53473653-53473675 CAGACGCCCCTCCCCCAGCCAGG + Intergenic
955056806 3:55462158-55462180 CATCGTTCCCTCCACCAGCTTGG - Intergenic
955361647 3:58281303-58281325 CAGACGCCCCTCCCCCAGCCAGG + Intronic
955464898 3:59226560-59226582 CAGATGCCCCTCCCCCAGCCAGG + Intergenic
955895384 3:63694336-63694358 CAGATGCCCCTCCCCCAGCCAGG - Intergenic
956240122 3:67120722-67120744 CAACTGGTACTCCACCAGCCTGG + Intergenic
956736140 3:72239804-72239826 TTGCTGTTCCTCCACCAGGCAGG + Intergenic
957377160 3:79372657-79372679 AAGCTGGCCATCCACAAGCCAGG + Intronic
959045306 3:101467119-101467141 CGGATGCCCCTCCCCCAGCCAGG - Intronic
959059763 3:101605515-101605537 CAGACGCCCCTCCCCCAGCCAGG + Intergenic
959308258 3:104696689-104696711 CGGATGCCCCTCCCCCAGCCAGG + Intergenic
960911268 3:122651369-122651391 CAGATGCCCCTCCCCCAGCCAGG - Intergenic
961241747 3:125417354-125417376 CAGCTGTCAATACAGCAGCCAGG + Intergenic
962137115 3:132746881-132746903 CAGATGCCCCTCCCCCCGCCAGG + Intergenic
962197150 3:133373972-133373994 CAGCTGTCCCAGCCCCAGCCAGG - Intronic
962318013 3:134370856-134370878 CAGCTGGCCCGCAACCAGCAGGG - Exonic
962540489 3:136376607-136376629 CAGCTGCCCATTCACCACCCAGG - Intronic
962602789 3:137007496-137007518 CAGATGCCCCTCCCCAAGCCAGG + Intronic
962624475 3:137211437-137211459 CAGATGCCCCTCCCTCAGCCAGG - Intergenic
962655967 3:137543998-137544020 CAGATGCCCCTCCCCCAGCCAGG - Intergenic
962766979 3:138574377-138574399 CAGATGCCCCTCCCTCAGCCAGG - Intronic
962861323 3:139404968-139404990 CAGATGCCCCTCCCCCAGCCAGG - Intergenic
964270035 3:154945570-154945592 CAGATGCCCCTCCCCCAGCCAGG - Intergenic
964933532 3:162053748-162053770 CAAATCTCCCTCCACAAGCCTGG + Intergenic
966583145 3:181591127-181591149 CAGATGCCCCTGCCCCAGCCAGG + Intergenic
967163120 3:186756985-186757007 CAGCTTTCCCTCCTCCACTCTGG - Intergenic
967756870 3:193179797-193179819 CAGATGCCCCTCCCCCAGCCAGG - Intergenic
968046463 3:195626416-195626438 CAGGTGGCCCTCCACAAGCCAGG - Intergenic
968092698 3:195908803-195908825 CACCTGTCCCTCCTGCACCCCGG + Intronic
968308190 3:197663675-197663697 CAGGTGGCCCTCCACAAGCCAGG + Intergenic
968905362 4:3448303-3448325 CAGCTGAGCCCCCACCAGTCGGG - Intronic
969166833 4:5323291-5323313 CAAGTCCCCCTCCACCAGCCAGG + Intronic
969253847 4:5989578-5989600 CAGCTGTCCACCCTGCAGCCGGG - Exonic
969483712 4:7460091-7460113 CAGCAGTCCCTCCCCCTGCATGG + Intronic
970573443 4:17404906-17404928 CAGCTGCCCCTGCCCCAGACTGG + Intergenic
971437258 4:26640835-26640857 CGGATGCCCCTCCCCCAGCCAGG - Intronic
972084650 4:35200645-35200667 CATCTGTGTCTCCACCAGTCTGG + Intergenic
973341829 4:49013200-49013222 CAGATGCCCCTCCCCCAACCAGG + Intronic
975751093 4:77524439-77524461 CAGATGCCCCTCTCCCAGCCAGG + Intronic
976790278 4:88870570-88870592 CAGATGCCCCTCCCCCAGCCAGG - Intronic
977331631 4:95643981-95644003 GAGCTGTCCTGCCACCAGCCAGG + Intergenic
977492898 4:97736645-97736667 CAGGTGCCCCTCCCCTAGCCTGG - Intronic
978477628 4:109148784-109148806 CTGCTGCCCCTCCTCCAGCCAGG + Intronic
979074777 4:116257606-116257628 CGGGCGCCCCTCCACCAGCCTGG + Intergenic
980631935 4:135447961-135447983 CGGGCGTCCCTCCCCCAGCCTGG - Intergenic
980877273 4:138674452-138674474 CATCTGTCCCTTCCCCACCCAGG + Intergenic
981655936 4:147112365-147112387 CAGATGTCCCTCCCCCAGCCAGG - Intergenic
982517217 4:156367692-156367714 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
982883290 4:160746774-160746796 CAGATGCTCCTCCCCCAGCCAGG - Intergenic
984434022 4:179685391-179685413 CGGATGCCCCTCCCCCAGCCAGG + Intergenic
985087616 4:186329545-186329567 CCGCGGTCACTCCACCTGCCAGG + Intergenic
985672657 5:1214304-1214326 CACCCGTCCCTCCACGAGCCTGG + Intronic
985791476 5:1930786-1930808 CAGCTGCCCCTCCACGCTCCGGG - Intergenic
986483457 5:8212311-8212333 CAGCTGTTCCAACACCAGCCAGG - Intergenic
987404552 5:17511842-17511864 CAGCTGTCCCGCCACCTCCGCGG - Intergenic
987949796 5:24660452-24660474 CAGACATCCCTCCCCCAGCCAGG + Intergenic
988023661 5:25655556-25655578 CAGATGCCCCTCCCCCAGCCAGG + Intergenic
988646564 5:33101600-33101622 CAGGTGCCCCTCCCCCAGCCTGG + Intergenic
988687567 5:33539959-33539981 CAGCTGTCCCTGCACCATGGAGG + Intronic
989137146 5:38167014-38167036 CTGCTGCCCCACCACCCGCCAGG + Intergenic
989345282 5:40422919-40422941 CAGATGCCCCTCCCCCTGCCAGG + Intergenic
989390540 5:40895783-40895805 CAGACGCCCCTCCCCCAGCCAGG - Intergenic
989671134 5:43918136-43918158 CAGACGACCCTCCCCCAGCCAGG + Intergenic
990234332 5:53750909-53750931 CAGACGCCCCTCCCCCAGCCAGG - Intergenic
990648412 5:57870441-57870463 CGGGTGCCCCTCCCCCAGCCTGG + Intergenic
991105459 5:62837505-62837527 CAGATGCCCCTCCCCCTGCCAGG - Intergenic
991387519 5:66106356-66106378 CAGATGCCCCTCCCCCAGCCAGG - Intergenic
992609853 5:78497946-78497968 CAGCTGTCCTTGCTGCAGCCAGG - Intronic
993358263 5:86941544-86941566 CGGATGTCCCTCCCCCAGCCAGG + Intergenic
994108539 5:95974193-95974215 CAACTGACACTCCACCAGACAGG - Intergenic
995090770 5:108173255-108173277 AAGCTATCCCTCCCCCATCCCGG - Intronic
997117255 5:131138615-131138637 CGGGTGCCCCTCCCCCAGCCTGG + Intergenic
997487394 5:134242975-134242997 CTGCCTTTCCTCCACCAGCCAGG + Intergenic
997529208 5:134571825-134571847 CTGCTCTGCCTCCCCCAGCCTGG + Intronic
997672632 5:135688802-135688824 CAGCTGCCCCCACTCCAGCCTGG + Intergenic
999158346 5:149474441-149474463 CAGCATTCCCTCCACTAGGCAGG + Intergenic
1000145166 5:158446916-158446938 CAGATGCCCCTCCCCCAACCAGG + Intergenic
1000404592 5:160873946-160873968 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
1000553621 5:162696466-162696488 CAGGCGCCCCTCCCCCAGCCTGG + Intergenic
1000851007 5:166340206-166340228 CAGCTGGCCCTCATCCAGCTTGG - Intergenic
1001901315 5:175432596-175432618 CAGCTGAGCCTCTACAAGCCAGG + Intergenic
1002066521 5:176654709-176654731 CCCCTCTGCCTCCACCAGCCTGG + Intronic
1002451658 5:179322421-179322443 CAGTTCTCCCTCCCCCACCCAGG + Intronic
1002554033 5:180020260-180020282 CAGCGGTCCTGCCACCATCCTGG - Intronic
1003520275 6:6852661-6852683 AAGCAATCCCTCCACCAGCTAGG - Intergenic
1003647514 6:7926103-7926125 CAGATGCCCCTCCCCCAGCCAGG - Intronic
1004082415 6:12407681-12407703 CAGCTCTCCCTCCCTGAGCCTGG + Intergenic
1006366462 6:33619145-33619167 CCTCTGTCTCTCCACCAACCAGG - Intergenic
1007321995 6:41034181-41034203 CAGCTCTCCCTCTCCCTGCCAGG - Exonic
1008332950 6:50264206-50264228 CAGCTGTCCTGCCACCATCCAGG - Intergenic
1008633175 6:53383138-53383160 CAGATGCCCCTCCCCCAGCCAGG - Intergenic
1009939047 6:70268238-70268260 AAGGTCTCCCTCCACCACCCAGG + Intronic
1010364254 6:75031260-75031282 CGGATGCCCCTCCCCCAGCCAGG - Intergenic
1010679612 6:78783554-78783576 CAGGTGCCCCTCCCCCAGCCTGG - Intergenic
1010747263 6:79578056-79578078 CAGATGCCCCTCTCCCAGCCAGG - Intergenic
1010755669 6:79663875-79663897 CGGCCGCCCCTCCCCCAGCCAGG + Intronic
1010961529 6:82151328-82151350 CGGACGTCCCTCCCCCAGCCAGG - Intergenic
1011304194 6:85908735-85908757 CAGATGCCCCTCCCCCTGCCAGG + Intergenic
1011537395 6:88391128-88391150 CAGATGCCTCTCCCCCAGCCAGG - Intergenic
1012262882 6:97108484-97108506 CAGGATTCCCTCCACCAGCATGG + Intronic
1012434888 6:99204708-99204730 CGGGTGCCCCTCCCCCAGCCTGG - Intergenic
1013667864 6:112366651-112366673 AAGAAGGCCCTCCACCAGCCAGG - Intergenic
1014938687 6:127413308-127413330 CAGATGCCCCTCCCCCAGTCAGG + Intergenic
1015880056 6:137863399-137863421 CAGTTGTCCCTCCACCATGGTGG + Intergenic
1016875855 6:148864204-148864226 CAGGCGCCCCTCCCCCAGCCTGG + Intronic
1017983425 6:159422284-159422306 CAGCTGTCCCGTCACCAGAGTGG + Intergenic
1018384273 6:163289002-163289024 AAGCAGTCCCTCCATCAGCGAGG + Intronic
1018705674 6:166461815-166461837 CAGCTCTTCCTCCATCATCCTGG + Intronic
1018794032 6:167172140-167172162 GAGCTGACCCTCCAGCATCCTGG - Exonic
1018822302 6:167382937-167382959 GAGCTGACCCTCCAGCATCCTGG + Exonic
1019309140 7:351817-351839 CCTCTCTCCCTCCAGCAGCCGGG + Intergenic
1019738587 7:2662089-2662111 CAGCTCTCCTTCCTCCCGCCCGG + Exonic
1020344159 7:7145326-7145348 TGGCTGCCCCTCCCCCAGCCAGG + Intergenic
1020571686 7:9871694-9871716 CAACTGAACCTCCACCAGCCAGG + Intergenic
1020609094 7:10372964-10372986 CAGATGCCCCTTCTCCAGCCAGG - Intergenic
1020774134 7:12432058-12432080 CAGATGCCCCTCCCCCAGCCAGG + Intergenic
1021798172 7:24278698-24278720 CAGATGCCCCTCCCCCAGCCAGG + Intergenic
1022097052 7:27147658-27147680 CAGCTGCCCCTCTACCAGGCTGG - Exonic
1022672737 7:32471548-32471570 CTGCTGCCACTCCACCTGCCAGG - Intergenic
1023651186 7:42371149-42371171 CAGATGCCCCTCCCCCAGCCAGG + Intergenic
1023864671 7:44233091-44233113 CAGCAGCACCTCCGCCAGCCTGG - Intronic
1024559761 7:50632940-50632962 CAGCTCTGCCGCCCCCAGCCAGG + Intronic
1024943138 7:54782757-54782779 CTGCACTCCCTCCACCACCCAGG - Intergenic
1026892781 7:73992167-73992189 CAGCGGGCCCTCTGCCAGCCCGG - Intergenic
1028078732 7:86547990-86548012 CAGACGCCCCTCCCCCAGCCAGG + Intergenic
1028578482 7:92380175-92380197 CAGATGCCCCTCCCCCAGCATGG - Intronic
1028822582 7:95229645-95229667 CTCCTGTCCCTCCCCCAACCTGG + Intronic
1029062289 7:97810776-97810798 CGGATGCCCCTCCCCCAGCCAGG - Intergenic
1029437990 7:100573329-100573351 CTGCTGCCCCACCACCTGCCAGG - Exonic
1029951952 7:104595769-104595791 CAGACGCCCCTCCCCCAGCCAGG + Intronic
1031157088 7:118122632-118122654 CAGACGCCCCTCCCCCAGCCAGG - Intergenic
1031434267 7:121713180-121713202 CAGATGCCCCTCCCCCAGCCAGG + Intergenic
1031524420 7:122807320-122807342 CATGTGTCCATCCACCAGGCTGG + Intronic
1032061978 7:128732463-128732485 AAGCTGTCCATCCCCCAGCTGGG + Intergenic
1032184150 7:129709132-129709154 CAGCTTTCTTTCCCCCAGCCTGG - Exonic
1032192308 7:129772037-129772059 CAGCTGTGGCCGCACCAGCCGGG + Intergenic
1032250677 7:130254753-130254775 CAGACGCCCCTCCCCCAGCCTGG + Intergenic
1032460038 7:132103434-132103456 CTCCTGTCCCTCCACCACCAGGG + Intergenic
1033405790 7:141071300-141071322 CTGCAGTCCCTCGACCAGCCGGG + Intergenic
1035183938 7:157111348-157111370 CATCTGTCCTTCCGTCAGCCTGG - Intergenic
1035270563 7:157717431-157717453 CAGCTGACCCTGCAGCACCCAGG - Intronic
1035642440 8:1194318-1194340 CCGGGCTCCCTCCACCAGCCGGG - Intergenic
1035797927 8:2376394-2376416 CAGCTTTCCCTGCATCATCCCGG + Intergenic
1036480093 8:9131832-9131854 CTGCACTCCCTCCACCAGACAGG - Intergenic
1036638376 8:10566710-10566732 CAGCTGTCCCACCACAAGGCTGG + Intergenic
1036741160 8:11362951-11362973 CAGTTGTTCCTCCTCCAGGCTGG - Intergenic
1036745706 8:11407674-11407696 CGGGTGCCCCTCCCCCAGCCTGG + Intronic
1036778765 8:11631472-11631494 CAGCTGGGCCCCCTCCAGCCTGG + Intergenic
1038229933 8:25690407-25690429 CAGCACTCCCTCACCCAGCCTGG - Intergenic
1039268457 8:35854507-35854529 CAGCTCACCCTCCACCTGGCAGG + Intergenic
1039500726 8:38014691-38014713 CAGCTGTACCTCAACCACCTCGG - Intergenic
1039832388 8:41225406-41225428 CAGATGCCCCTCCCCCAGCCAGG - Intergenic
1040608538 8:48959585-48959607 CAGGCGCCCCTCCCCCAGCCTGG + Intergenic
1041909870 8:63077595-63077617 CAGATGCCCCTCCCCCAGCCAGG - Intronic
1042308703 8:67358652-67358674 CAGATGCCCCTCCCCCAGCCAGG + Intergenic
1042696651 8:71561081-71561103 CAGCACTCCCTCCTCCACCCCGG + Intronic
1042833435 8:73055919-73055941 CAGGCGCCCCTCCCCCAGCCAGG - Intergenic
1043421616 8:80104145-80104167 GAGCTGTCCAGCCACCATCCAGG + Intronic
1044521588 8:93205434-93205456 CAGATGCCCCTCCCCCTGCCAGG + Intergenic
1044755630 8:95458316-95458338 CAGCTGTACTTCCACCAGGTAGG - Intergenic
1045343787 8:101276474-101276496 CAGAGGTGCCTCCATCAGCCAGG + Intergenic
1048121211 8:131583522-131583544 CTGCTGTCACTTCACCGGCCTGG + Intergenic
1048603485 8:135943595-135943617 CTGCTGTCCCTGCACCACCATGG - Intergenic
1048944885 8:139435977-139435999 CAGCTGGCCCTCAGCCATCCTGG - Intergenic
1049385903 8:142342870-142342892 CACCTGTCCCAGCACCTGCCCGG + Intronic
1049385930 8:142342999-142343021 CACCTGTCCCAGCACCTGCCCGG + Intronic
1049402384 8:142434214-142434236 CAGCTGTCACTACAGCAACCAGG - Intergenic
1049677720 8:143899845-143899867 CAGCAGTCATTCCATCAGCCTGG - Intergenic
1049757250 8:144316188-144316210 CAGCTGTCCCAGGACCTGCCGGG - Exonic
1049791296 8:144473884-144473906 GGGCTCTCCCTCCCCCAGCCTGG + Exonic
1049853187 8:144845298-144845320 CAGCTGTGCCTGCACCTGCTGGG - Intronic
1050083191 9:1936769-1936791 CAGGCGTCCCTCCCCCAGCCTGG + Intergenic
1050671997 9:8008079-8008101 CAGATGCCCCTCCATCTGCCAGG + Intergenic
1052063783 9:23992105-23992127 CGGATGCCCCTCCCCCAGCCAGG - Intergenic
1053120885 9:35546903-35546925 CAGCAGTCCTTCCACCTGCATGG + Exonic
1054890005 9:70240717-70240739 CGGATGCCCCTCCCCCAGCCAGG - Intergenic
1054905780 9:70412975-70412997 CCGCTCTCCCTCCTCCATCCTGG - Exonic
1057270452 9:93647378-93647400 CAGCTGTCCCTGCAGAAGCAGGG + Intronic
1057936390 9:99242923-99242945 CAGCTGTCCCTTCACCTTTCTGG + Intergenic
1057998798 9:99844663-99844685 CATCTGTGCCTGCAGCAGCCTGG - Exonic
1058150129 9:101454517-101454539 GAGCTGTCCCGCCACCATCCAGG + Intergenic
1058202990 9:102066892-102066914 CAGTTGCCCCTCTCCCAGCCAGG + Intergenic
1058370888 9:104266204-104266226 GAGCTGTCCTGCCACCATCCAGG + Intergenic
1058614329 9:106809593-106809615 CAGATGCCCCTCCCCCTGCCAGG - Intergenic
1058819263 9:108713890-108713912 CAGATGCCCCTCCCCCAGCCAGG - Intergenic
1058926114 9:109665898-109665920 CGGATGCCCCTCCCCCAGCCAGG + Intronic
1059387221 9:113974030-113974052 CTGCTGTGCCTCCAGCACCCAGG - Intronic
1059456318 9:114402419-114402441 CTGCTGTCCCCCCTCCAGCTAGG - Exonic
1060847534 9:126849207-126849229 CTGCAGCTCCTCCACCAGCCTGG + Intergenic
1060850342 9:126869575-126869597 CAGCCGCCCCCACACCAGCCTGG - Intronic
1060881265 9:127119891-127119913 CAGGTTTCCCTGCTCCAGCCTGG - Intronic
1060931058 9:127489826-127489848 CTGCTGTCCCTGCTCCAGGCAGG + Intronic
1061046531 9:128168088-128168110 CAGCTGGCCCCTCACCACCCTGG + Intronic
1061369689 9:130191443-130191465 CAGCCTTCCTCCCACCAGCCCGG + Intronic
1062287256 9:135778670-135778692 CCTCGGTCCCGCCACCAGCCTGG + Exonic
1062402331 9:136378090-136378112 AAGCTGCCCCTGCGCCAGCCTGG - Exonic
1062434699 9:136541755-136541777 GACCTGTGCCTCCACAAGCCGGG + Intronic
1186914630 X:14206579-14206601 CAGACGCCCCTCCCCCAGCCTGG + Intergenic
1187105378 X:16236408-16236430 CAGGCGCCCCTCCCCCAGCCTGG + Intergenic
1188954565 X:36418573-36418595 CGGGTGCCCCTCCCCCAGCCAGG + Intergenic
1190622261 X:52299135-52299157 CAGACGTCCCTCCCCCAGCCAGG - Intergenic
1190683405 X:52849266-52849288 CAGATGCCCCTCCCCCAGCCAGG + Intergenic
1191645673 X:63478428-63478450 CAGACGCCCCTCCGCCAGCCAGG - Intergenic
1191772373 X:64775031-64775053 CGGATGCCCCTCCCCCAGCCAGG - Intergenic
1191953750 X:66622350-66622372 CAGCTGCACCCCCAGCAGCCTGG - Intronic
1192265630 X:69535751-69535773 GAGCTCTCCCTCCCTCAGCCAGG + Intergenic
1192294836 X:69836442-69836464 CAGACGCCCCTCCCCCAGCCAGG + Intronic
1192395904 X:70780742-70780764 CAGATGCCCCTCCCCCAGCCAGG - Intronic
1192727519 X:73768331-73768353 CAGGTGCCCCTCCCCCAGCAAGG - Intergenic
1192825929 X:74696118-74696140 CAGATGCCCCTCCCCCAGCCAGG - Intergenic
1192973762 X:76261242-76261264 CAGATGCCCCTCCCGCAGCCAGG + Intergenic
1193435938 X:81475161-81475183 CACATGCCCCTCCCCCAGCCAGG + Intergenic
1195101899 X:101562994-101563016 GAGCTGTCTCACCACCATCCTGG + Intergenic
1197438384 X:126460369-126460391 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
1197624122 X:128783079-128783101 CAGGCGCCCCTCCCCCAGCCTGG - Intergenic
1198341047 X:135713669-135713691 CTGCTGTCTCTCCTCCAGCAAGG + Exonic
1199344185 X:146719473-146719495 CAGACGCCCCTCCCCCAGCCAGG - Intergenic
1199779717 X:151046952-151046974 CAGCTGTCCCTCCTCAAGATGGG - Intergenic
1199911826 X:152295404-152295426 CAGATGCCCCTCCCCCTGCCAGG + Intronic
1199939603 X:152612305-152612327 CAGACGCCCCTCCCCCAGCCAGG + Intergenic
1200737387 Y:6814264-6814286 CAGATGCCCCTCTCCCAGCCAGG - Intergenic
1202065034 Y:20929884-20929906 CAGCTGACGCTCCCACAGCCTGG - Intergenic
1202343133 Y:23889887-23889909 TGGCTGTCCCTCTACCAGCTAGG - Intergenic
1202527635 Y:25780198-25780220 TGGCTGTCCCTCTACCAGCTAGG + Intergenic