ID: 902486508

View in Genome Browser
Species Human (GRCh38)
Location 1:16750167-16750189
Sequence CAGGCTCAGGCCTCTGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 3, 1: 0, 2: 0, 3: 34, 4: 217}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902486508_902486526 27 Left 902486508 1:16750167-16750189 CCCCCTACAGAGGCCTGAGCCTG 0: 3
1: 0
2: 0
3: 34
4: 217
Right 902486526 1:16750217-16750239 CCAGGGCCCTTCCCTGCAGCTGG 0: 4
1: 1
2: 3
3: 52
4: 456
902486508_902486514 -10 Left 902486508 1:16750167-16750189 CCCCCTACAGAGGCCTGAGCCTG 0: 3
1: 0
2: 0
3: 34
4: 217
Right 902486514 1:16750180-16750202 CCTGAGCCTGCCTTCCCAGGAGG 0: 4
1: 0
2: 2
3: 46
4: 366
902486508_902486516 -4 Left 902486508 1:16750167-16750189 CCCCCTACAGAGGCCTGAGCCTG 0: 3
1: 0
2: 0
3: 34
4: 217
Right 902486516 1:16750186-16750208 CCTGCCTTCCCAGGAGGCCCAGG 0: 4
1: 2
2: 8
3: 80
4: 753
902486508_902486520 9 Left 902486508 1:16750167-16750189 CCCCCTACAGAGGCCTGAGCCTG 0: 3
1: 0
2: 0
3: 34
4: 217
Right 902486520 1:16750199-16750221 GAGGCCCAGGACTCTCACCCAGG 0: 4
1: 0
2: 2
3: 23
4: 270
902486508_902486521 10 Left 902486508 1:16750167-16750189 CCCCCTACAGAGGCCTGAGCCTG 0: 3
1: 0
2: 0
3: 34
4: 217
Right 902486521 1:16750200-16750222 AGGCCCAGGACTCTCACCCAGGG 0: 4
1: 0
2: 1
3: 29
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902486508 Original CRISPR CAGGCTCAGGCCTCTGTAGG GGG (reversed) Intronic
902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
902486508 1:16750167-16750189 CAGGCTCAGGCCTCTGTAGGGGG - Intronic
902771871 1:18649814-18649836 CAGGCTAGGGCCTCTGCATGGGG - Intronic
903266536 1:22161255-22161277 CAGGCTCAGGCCTTTGGAGCAGG - Intergenic
903336705 1:22629225-22629247 CAGGCCCAGCCCTCTCAAGGTGG + Intergenic
904402099 1:30263643-30263665 CAGGCTCTGTCCTCTGTCAGTGG + Intergenic
904936232 1:34131646-34131668 CAGGCCCAGGCCTCTCTCTGAGG + Intronic
905303217 1:36999512-36999534 CTGCCTCAGGCCTCTGTGGGTGG - Intronic
905890270 1:41514499-41514521 CGGACTCTGGCCTCTGTGGGCGG + Intronic
906890651 1:49709368-49709390 CATGCTGAGGCTTGTGTAGGTGG - Intronic
907299540 1:53477912-53477934 CTGGCTCAGGCAGCTGGAGGTGG - Intergenic
912415007 1:109502164-109502186 AAGGCTCAGGCCCCTGCAGTGGG - Intronic
912956836 1:114160050-114160072 TATGCTCAGGGCTCTGTATGTGG - Intergenic
918144388 1:181742735-181742757 CAGGCACACGCCTCGGCAGGAGG - Intronic
919589402 1:199481722-199481744 CAGTCCCAAGCCTTTGTAGGAGG - Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
922281120 1:224125263-224125285 CAGGCTCATGCCTCTGTACCTGG + Intronic
1063198307 10:3763419-3763441 CAGGATCTGACCTCTGCAGGGGG - Intergenic
1064112893 10:12553645-12553667 AAGACTCAGGGCTCTGTAGCCGG - Intronic
1067689137 10:48490129-48490151 CAGACTCATGCACCTGTAGGGGG + Intronic
1068848175 10:61704495-61704517 CTCACTCAGGCATCTGTAGGTGG - Intronic
1069719375 10:70539777-70539799 CAGGCTGAGGCCTCTGGGGAGGG + Intronic
1070777616 10:79119003-79119025 CCTGCTCAGGCCTCTGCAGAAGG - Exonic
1071285863 10:84144466-84144488 CTGCCTCAGGCTCCTGTAGGTGG + Intronic
1072324924 10:94288519-94288541 CAGTCTCAGGCCTCTCTACCAGG + Intronic
1074771186 10:116735480-116735502 CAAGCTCAGGCTTCTTTATGTGG - Intronic
1075709170 10:124521543-124521565 CAGGCTCTGTCCTCTGTTGGTGG + Intronic
1075714321 10:124547476-124547498 CATGCTCACACCTCTGTGGGTGG - Intronic
1076806032 10:132859235-132859257 CAGGCTCAGGCACCTGACGGAGG + Exonic
1081747907 11:45485904-45485926 CAGGCCCAGGCTGCTGGAGGTGG - Intergenic
1083611801 11:64007886-64007908 CAGCCTCGGCCCTCTGGAGGCGG - Intronic
1083869226 11:65476995-65477017 CAGGCCCAGGCCTGGGCAGGTGG + Intergenic
1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG + Intergenic
1084383411 11:68827874-68827896 CAGGGCCAGGGCTGTGTAGGTGG - Intronic
1084795239 11:71500935-71500957 CCAGCTCTGGCCTCTGTAGTGGG + Intronic
1088226034 11:107621284-107621306 CAAGCTCAAACCTCTGTGGGAGG + Intronic
1090909508 11:131106168-131106190 CAGGCTCAGCACACTGTAGTTGG + Intergenic
1090914519 11:131151423-131151445 CAGGTTCAGGGCTCTGCAGAAGG + Intergenic
1091296641 11:134478409-134478431 CAGGCTCAGGCCTCAGAGGCAGG - Intergenic
1093612837 12:21183039-21183061 CAGGCACAGGCCTGTTAAGGGGG + Intronic
1095338468 12:41059745-41059767 CAGGCTCAGGCCACTGCACTTGG - Intronic
1095599981 12:44002865-44002887 CAGGGACAGGACTTTGTAGGTGG + Intronic
1095921136 12:47532538-47532560 CAATCTCAGGCATCTGTGGGAGG + Intergenic
1096576024 12:52553392-52553414 CAGGCCCTGGCCTCTCCAGGGGG + Intergenic
1097145902 12:56939214-56939236 CAGGGCCAGGCCTGTGGAGGAGG - Intergenic
1097151463 12:56982752-56982774 CAGGGCCAGGCCTGTGGAGGAGG - Intergenic
1098592694 12:72232304-72232326 CAGGCTCTGGCCTATAGAGGTGG + Intronic
1101137256 12:101757018-101757040 CAGGCTCATCCCTCTGCATGGGG + Intronic
1104648209 12:130511966-130511988 CAAGCTCAGGCTTCTGTGAGGGG + Intronic
1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG + Intergenic
1106186075 13:27411037-27411059 CAGGATAAGGGCTCTGTAGCAGG + Intergenic
1106780804 13:33057203-33057225 CAGGTTCAGTCCTTTGTATGCGG + Intronic
1107709786 13:43140479-43140501 CAAGCACAGGCCTCTGGAAGTGG - Intergenic
1107817062 13:44253867-44253889 TAAACTCAGGCCTCTGTAGTAGG - Intergenic
1107979507 13:45720992-45721014 CAGGGTCAGGCTTCTGGAGATGG + Intergenic
1108673233 13:52712627-52712649 CATGCTCAGGCCTGTGGAGGGGG + Intronic
1109651810 13:65336880-65336902 CAGCCTCAGGCCTCTCTTGGGGG - Intergenic
1112064762 13:95781267-95781289 CAGGCTCTGGCCCCTGTATATGG - Intronic
1119088573 14:71759570-71759592 CAGGCTCAAGCCTCCCTAGCTGG + Intergenic
1119195531 14:72714482-72714504 CAGGCTCGCGGCTCTGCAGGGGG - Exonic
1122906975 14:104806103-104806125 CATGATCGGGCCTCTGTGGGGGG - Intergenic
1122977239 14:105175867-105175889 CGGGCCCTGGCCTCTGGAGGAGG + Intronic
1123059744 14:105589118-105589140 TGGGCTCAGGGCTCTGCAGGTGG + Intergenic
1123084066 14:105709367-105709389 TGGGCTCAGGGCTCTGCAGGTGG + Intergenic
1124139701 15:27066663-27066685 CAGGCTCTGGCCTCTCTCTGTGG - Intronic
1125753865 15:42049248-42049270 GAGGCTCGGGCCTCTGCTGGTGG - Intronic
1129114556 15:73358030-73358052 CAGGGTCGGGCCTCAGTATGAGG - Intronic
1130997566 15:88912472-88912494 CAGGGCCAGGACTCTTTAGGTGG - Intronic
1132764752 16:1528766-1528788 CGGGCTCGGGGCTCTGTGGGCGG - Intronic
1132931792 16:2462432-2462454 CAGGCTCAGTGCTGTGGAGGTGG + Exonic
1133882790 16:9798520-9798542 CAGGATCAGGCCTCAGGAGCTGG - Intronic
1134250767 16:12572356-12572378 CAGGCTCTGCCTTCTGGAGGCGG + Exonic
1134408230 16:13981504-13981526 TAGGTTCAGGCCTGTTTAGGTGG + Intergenic
1136019968 16:27434045-27434067 CGGGCGCAGGGCTCTGGAGGAGG + Intronic
1136092222 16:27928693-27928715 CAGGCCCAGGCCTCGGGAGAGGG + Intronic
1139424054 16:66868053-66868075 CAGGCTCAGGCCCCGGGTGGTGG - Intronic
1139563844 16:67760568-67760590 CAGGCCCTGGCCTTTGTGGGAGG - Intronic
1139937515 16:70582220-70582242 CAGGCTCAGGCCTCCCTCTGGGG + Intronic
1140760215 16:78102865-78102887 CAGCCGCAGGCTTCTGTGGGTGG + Intronic
1140942587 16:79735802-79735824 CACCCTCAGTCCTCAGTAGGAGG - Intergenic
1141744021 16:85913900-85913922 CAGGCCCAGGCTTCTGCAGCCGG + Intronic
1141787521 16:86211616-86211638 CAGAACCTGGCCTCTGTAGGTGG - Intergenic
1143178089 17:4967972-4967994 CAGCCTCCGGCCTCTGTCTGCGG - Intronic
1143239187 17:5429559-5429581 CAGGCTCAGGCCTTGGTGGAAGG + Intronic
1143536297 17:7542074-7542096 CAGGCTCAGGCCGCTTGCGGTGG + Intergenic
1143684799 17:8505018-8505040 CAGCCTCAGGCCCCAGGAGGAGG - Intronic
1143974490 17:10820034-10820056 CAGGCTCAGGGCTCTGGGGATGG + Intergenic
1144029026 17:11303618-11303640 CAGGCTCAGCCTTCTGCATGTGG - Intronic
1144635725 17:16907717-16907739 CTGGCCCAGGGCTCTGCAGGTGG - Intergenic
1144671651 17:17136209-17136231 CAGGCCCAGGCTCCTGGAGGAGG - Exonic
1147402508 17:40189423-40189445 CAAGCTCAGGGCTCTGGGGGAGG + Intronic
1148385070 17:47228381-47228403 GAGGCTCTGGCCTCTGTCAGGGG - Intergenic
1148998693 17:51734883-51734905 CAGGCTCAGTTCTCTGGTGGAGG + Intronic
1150739175 17:67765812-67765834 CAGGCACAGGTCTCTGGGGGAGG - Intergenic
1151803541 17:76391603-76391625 CAGGATCAGACCTGTGTGGGCGG + Exonic
1151928009 17:77213024-77213046 CAGGCTCCTGCCTCCGTAGGTGG + Intronic
1152610609 17:81313485-81313507 CAGCCTGTGGCCTCTGCAGGAGG - Exonic
1153543201 18:6179466-6179488 CAGGCTCTGGGCTCTGTTGAGGG + Intronic
1153978594 18:10290646-10290668 GAAGCTCAGGCCTCTGTCTGGGG + Intergenic
1157570726 18:48710335-48710357 CATGCTCAGGTCGCTGCAGGTGG + Intronic
1158342644 18:56483462-56483484 CAGGCTCAAGCCTCTGGAGTGGG - Intergenic
1158520594 18:58169109-58169131 CAGGCACAGGCCTCTCAAGGGGG - Intronic
1159115443 18:64107908-64107930 CAGGCTCAGGCCATTGAAGGTGG + Intergenic
1160591275 18:79945882-79945904 CAGCCTCAGGTCTCTGTGGGTGG - Intronic
1161955801 19:7494247-7494269 CAGGCACAGGCCACTGCAGCTGG - Intronic
1162722517 19:12670729-12670751 CTGGCTCAGGCCTCCGTGAGCGG - Exonic
1163162796 19:15475625-15475647 CTGGCTCCAGCCTCTGTAGAAGG + Exonic
1165509043 19:36255557-36255579 CAGGCTCAGGCCTGCGTGGACGG + Intergenic
1165549602 19:36573158-36573180 GAGCCTGAGGCCTCTGTACGCGG - Exonic
1166228932 19:41414300-41414322 CAGGGTTAGGACTCTGGAGGGGG + Intronic
1168306507 19:55438828-55438850 CAGGCTCAGGGCTGGGTAAGTGG + Intronic
1168342953 19:55636190-55636212 CAGGGTCAGGCCAGTGTGGGAGG + Intronic
1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
926214055 2:10892835-10892857 CAGGCGAAGGCCTCTGGAGATGG + Intergenic
927319937 2:21731543-21731565 CATGATCAAGCATCTGTAGGTGG - Intergenic
927880726 2:26688297-26688319 CAGGGTCAGGCCTGAGAAGGGGG - Intergenic
928207539 2:29296929-29296951 CAGGCTCAAGCCTTCATAGGCGG + Exonic
929830606 2:45343789-45343811 CTGGCTCAGGGCTCTGCTGGGGG + Intergenic
931472554 2:62553503-62553525 CAGGCTCCTGCCACTGCAGGTGG - Intergenic
933973105 2:87486152-87486174 CAGACGCCGGCCTCTGTGGGCGG - Intergenic
936151404 2:110024163-110024185 CTGCCCCAGGCCACTGTAGGTGG + Intergenic
936193271 2:110347206-110347228 CTGCCCCAGGCCACTGTAGGTGG - Intergenic
936320615 2:111464061-111464083 CAGACGCCGGCCTCTGTGGGCGG + Intergenic
936591083 2:113805171-113805193 CTGGCTCAAGCCACTGTAGTAGG - Intergenic
936847787 2:116857459-116857481 CAGGTTCAGTCTTCTGTATGTGG - Intergenic
940719051 2:157261426-157261448 CAGGCTCTGTCTTCTGAAGGAGG + Intronic
941029246 2:160493211-160493233 CAGGGTCAGGCCTGGGGAGGGGG - Intronic
943259238 2:185637199-185637221 CAGGTTGAGGCCTTTGTAAGTGG + Intergenic
945924655 2:215790826-215790848 CAGGCTCAGCCATCTTCAGGAGG - Intergenic
946880800 2:224175630-224175652 GAGACTCAGACCTCTGAAGGAGG + Intergenic
947642472 2:231714674-231714696 CAGGTTGAGGCCTTGGTAGGAGG + Intergenic
948768373 2:240234849-240234871 CAGACACAGGCCTCTGGGGGTGG + Intergenic
1168947469 20:1773489-1773511 CAGGCTCAGATCGCTGAAGGGGG + Intergenic
1169530627 20:6481313-6481335 AAGGCTGAGGCCTCAGAAGGTGG + Intergenic
1169641475 20:7757215-7757237 CAGGCCCAGGCTTCTTGAGGTGG + Intergenic
1172446225 20:34994837-34994859 CAGGCTCAGGCTAGTGCAGGAGG + Intronic
1173479944 20:43390537-43390559 CAGCCTCCGGCCTCTGAAGGGGG + Intergenic
1174131463 20:48346414-48346436 CAGGCACAGGCCACTGTACCTGG + Intergenic
1175138361 20:56841731-56841753 CAGGGACAGGCGTCTGGAGGAGG + Intergenic
1175297824 20:57921318-57921340 CGAGCTCAGGCCTATGGAGGTGG + Intergenic
1178817889 21:35948321-35948343 GGGGCTCAGGGCTCTTTAGGAGG - Intronic
1181041108 22:20193029-20193051 CTGTGTCAGGCCTCTGTGGGAGG + Intergenic
1181424588 22:22825495-22825517 AAGCCTCAGGCCACTATAGGAGG - Intronic
1181495148 22:23283484-23283506 CAGGCACAGGCCCCTGTGGTGGG - Intronic
1182685439 22:32119542-32119564 CTGGCTCAGGCCCCAGAAGGAGG + Intergenic
1183301752 22:37062228-37062250 CAGAATCTGGCCTCTGTAGGTGG + Intronic
1183320750 22:37163749-37163771 CAGGCTCAAGCCCATGTGGGTGG - Intronic
1183501503 22:38182121-38182143 CAGGCTCTGGTCGCTTTAGGAGG - Intronic
1183702078 22:39456680-39456702 CAGGCCCAGGCCTCTGCACATGG + Intergenic
1184355295 22:43975550-43975572 CCGGCTCAGGCCTCTGCTGCAGG + Intronic
1184570323 22:45319481-45319503 CAGGCTCTGGCCTGTGGATGAGG - Intronic
1184590200 22:45476910-45476932 CAGGCCTTAGCCTCTGTAGGCGG - Intergenic
1184678950 22:46059448-46059470 CAGAACCAGGCCTCTGGAGGGGG + Intronic
1184691983 22:46121625-46121647 GAGGCCCAGGTCTCTCTAGGTGG + Intergenic
1184875679 22:47273986-47274008 CAGGCTCCTGCCTCTATAGGAGG - Intergenic
1184982391 22:48103735-48103757 CAGGCTGGCCCCTCTGTAGGGGG + Intergenic
1185301622 22:50083974-50083996 CATGCTCAGGCCACGGGAGGTGG + Intronic
1185402195 22:50625068-50625090 GAGGCTCAGGTGTCTGGAGGGGG - Exonic
950427633 3:12933025-12933047 CTGGCACAGGCCTCTGTCTGGGG - Intronic
951341066 3:21487695-21487717 CAGGATCAGTCCTCTGAAGCTGG + Intronic
951840238 3:27026390-27026412 CAGGCTGAGTCCTCTCTAGAGGG - Intergenic
952140108 3:30468800-30468822 CAGGCCCAGTCCTATGTTGGAGG + Intergenic
953043942 3:39278885-39278907 CAGGCTCAGGTTTGTGTGGGTGG - Intronic
953994803 3:47511743-47511765 CATGATCAGGCCTCTGAAGCAGG - Intronic
954269836 3:49499257-49499279 CAGGCACAGGCCACTGTACCCGG - Intronic
954391135 3:50268694-50268716 GGGGGTCAGGCCTCTGGAGGTGG - Intronic
954613953 3:51960083-51960105 CAGGCTCAGAGCTCTCTAGGTGG + Intronic
955346947 3:58168329-58168351 CAGGGTGAGCCCTCTGTAAGGGG + Intronic
955774163 3:62415718-62415740 CAGTCTCAGGCCTTTATACGAGG - Intronic
958094535 3:88926388-88926410 CTGGCTCAGGCCCTTGTAGAAGG + Intergenic
960438724 3:117660427-117660449 AGGGCTCAAGCATCTGTAGGTGG + Intergenic
961773684 3:129268650-129268672 CAAGGCCAGGCCTCTGTTGGAGG + Intronic
961829476 3:129616082-129616104 CAGGCTGATGGCTCTGAAGGGGG + Intergenic
962368600 3:134802618-134802640 CAGGCCCAGGCTTGTGCAGGTGG + Intronic
964634796 3:158847219-158847241 TAGGCTCAGGACTCTGAAAGGGG + Intergenic
965769444 3:172166610-172166632 CAGGCACAGGCCACTGTACCTGG - Intronic
966895987 3:184445553-184445575 CAGGCTCAGGCCTCTGCTAAGGG + Intronic
968451573 4:678491-678513 CAGCCTCAGGCCTGGGTAGCTGG - Intronic
968483606 4:848378-848400 GAGGCTCAGGCCCCTGACGGAGG + Intergenic
968512306 4:1001096-1001118 CAGGCGCAGGCCCTTGTGGGGGG + Intronic
969057925 4:4413698-4413720 CAGGCACAGGCCCCTGGAGGAGG + Intronic
969197441 4:5574217-5574239 CAGCCTCAGGGCTCTGTATCAGG + Intronic
969468487 4:7371800-7371822 CACGCCCAGGCCTCTGACGGAGG + Intronic
969522192 4:7684884-7684906 CAGGGTCAGGGCTCTCTGGGAGG - Intronic
969758917 4:9168563-9168585 CAGGCCCAGGCCACTGGAGGAGG + Intergenic
971244613 4:24916981-24917003 AGGTCTCAGGCCTCTGCAGGAGG - Intronic
972992670 4:44841080-44841102 CAGTCTCAGGACAGTGTAGGGGG + Intergenic
975169031 4:71212404-71212426 GAGGCCCAGGCCTCTGGAGCTGG + Intronic
983649760 4:170026415-170026437 CCGGCCCAGGCTCCTGTAGGTGG - Intronic
986264146 5:6178431-6178453 TAGGCTCAAGCCTTTGTAGATGG - Intergenic
986724804 5:10586248-10586270 CAGAGTCAGCCCTCTGTAGGTGG + Intronic
996602361 5:125279115-125279137 CAGGCTTAGAACTCTGTAGCTGG + Intergenic
998012563 5:138707235-138707257 CTGGCTGAGGGCTCTGCAGGAGG + Intronic
998368083 5:141644089-141644111 GAGGCCCAGGCCACTGTAGGAGG + Intronic
999194250 5:149771318-149771340 CAGGCTCAGGGCCATTTAGGTGG + Intronic
1001553685 5:172622151-172622173 CAGCCTCAGATCTCAGTAGGAGG - Intergenic
1001875154 5:175194017-175194039 CATGCCAAGGCCTCTGTATGTGG + Intergenic
1001999249 5:176188274-176188296 CAGGCTCTGGCCTTGGCAGGAGG - Intergenic
1004979593 6:21008398-21008420 CAGGGTCAGGCCCGTGGAGGTGG + Intronic
1005841074 6:29744907-29744929 CAGGTTCAGGCTTCTATAGGAGG + Intergenic
1005870499 6:29971444-29971466 CAGGTTCAGGCTTCTGTCAGAGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006416977 6:33910497-33910519 CAGCCTCAGGCCTGTGGAGAGGG + Intergenic
1006444003 6:34068807-34068829 CTGGCTCAGGGGTCTGGAGGAGG - Intronic
1006837312 6:37006844-37006866 CAGGCTGAGGCCTCTGTGGCAGG - Intronic
1007397048 6:41583859-41583881 CTGGGTCAGGCCTCTATAGAAGG - Intronic
1008137669 6:47795372-47795394 CTGGCCCAGGCCTCGGTAGGGGG + Exonic
1011503543 6:88016766-88016788 CAGGCCCAGGCATCTGTAGCAGG - Intergenic
1012523733 6:100152104-100152126 CAGGCCAAGGCCCCTGTAAGGGG + Intergenic
1013285499 6:108677716-108677738 CAGGCACAGTCCTCTGGAAGAGG - Intronic
1015547960 6:134381209-134381231 CAGGCTCAGCACTCTTTTGGAGG - Intergenic
1017811994 6:157990182-157990204 CAGGCCCAGGCCGCAGGAGGTGG + Intronic
1018956490 6:168413579-168413601 CCGGCTCAGGCCTCCGCAGCCGG - Intergenic
1019103126 6:169648205-169648227 CAGTCTCATGCCGCTGTGGGTGG + Intronic
1019471611 7:1224264-1224286 AAGGCTCCGGCTTCTGCAGGCGG + Intergenic
1020008015 7:4792458-4792480 CAGCCTCAGGACTATGGAGGGGG + Intronic
1022504775 7:30903209-30903231 CAGGCCCAGGCCTGTGAAGAAGG - Intergenic
1022813022 7:33887650-33887672 GAAGCTTAGGCCTCTGAAGGTGG - Intergenic
1024237917 7:47412040-47412062 CAAGCTCGGGCCTCTGGAGTTGG - Intronic
1025809685 7:64867911-64867933 CAGGCTCAGGCATCTGATGATGG - Intergenic
1026295365 7:69047494-69047516 CAGGCTAAGGCCTCCCTAGGGGG + Intergenic
1026658265 7:72276203-72276225 CAGGCTCAGTCATCAGCAGGAGG - Intronic
1026830580 7:73607610-73607632 CAGCCTCAGGCCCCTGCAGGGGG + Exonic
1027659755 7:80975051-80975073 CAGGCTCAGCTCTCCGTAGTAGG - Intergenic
1028020815 7:85768679-85768701 CAGCCTCAGGCCTCTGCTGGAGG - Intergenic
1029459809 7:100688091-100688113 CAGGCTCAGGGCCCTGTCCGGGG - Exonic
1034529911 7:151689313-151689335 CAGGCTCACGGCTCTGGATGAGG + Intronic
1035031355 7:155863143-155863165 GAGGGACAGGCCTCTGTGGGAGG - Intergenic
1035596921 8:865813-865835 CAAGCTCAGGACCCTGTAGCTGG - Intergenic
1035687228 8:1533812-1533834 CAGGCTCAGGCCGCTGTGCCAGG - Intronic
1040278274 8:46024929-46024951 AAGGCCCAGGCCTCTGTAAGAGG + Intergenic
1040278635 8:46026448-46026470 AAGGCCCAGGCCTCCGTAGGAGG + Intergenic
1042375935 8:68052242-68052264 CTGACTCAGGCCTCTGTCGTAGG + Intronic
1047212000 8:122847805-122847827 CAGTCTCCGCCCTCTGAAGGTGG + Intronic
1048335154 8:133497056-133497078 TAGGCTCAGGCCCCTGTGTGCGG - Intronic
1049360321 8:142209685-142209707 GAGGCTCAGGCTGCTGTGGGAGG - Intergenic
1051394189 9:16601598-16601620 CAGGCTCAGGAGTGTGTAGTAGG - Intronic
1052955402 9:34249987-34250009 CAGGCTCAGACCTGTGGAGCTGG + Intronic
1059344037 9:113616270-113616292 CAGGCTCCAGGCTCTGGAGGAGG + Intergenic
1060291505 9:122307209-122307231 CAGGCCCATGCTCCTGTAGGGGG + Intronic
1060544782 9:124453454-124453476 CAGGATCAGGACTCTCTGGGCGG + Exonic
1060596408 9:124851803-124851825 TTGGCTCAGGCATCTGTAGGTGG - Intergenic
1062158257 9:135066023-135066045 CACCCTCAGGCCTCTGCATGGGG + Intergenic
1062269377 9:135701685-135701707 CAGGCTGCGGCATCTGTGGGTGG - Intergenic
1188003179 X:25001048-25001070 CTGGGACAGGCCTCTGTGGGAGG - Intergenic
1189224822 X:39403762-39403784 CAGGATCAAGCCTCTGAAGAGGG + Intergenic
1189974572 X:46448289-46448311 TAGGCTGAGGCCTCAGAAGGAGG + Exonic
1190420828 X:50282557-50282579 AAGGCTCAGGGTTCTGTAGGTGG + Intronic
1198821211 X:140650468-140650490 CAGGCTCAGGGCTGTTTGGGAGG - Intergenic
1199756948 X:150873814-150873836 CAGGCTCAGGCCCTGGTTGGAGG - Intronic
1200073288 X:153539287-153539309 CAGGCTCGGGCCTCAGCAAGAGG + Intronic
1200421307 Y:2971789-2971811 CAGGCTCAGGCCACTGCACTTGG - Intronic
1201728181 Y:17177377-17177399 CAGGGTCATGCCTCTGCATGTGG - Intergenic