ID: 902490755

View in Genome Browser
Species Human (GRCh38)
Location 1:16779044-16779066
Sequence CTGGAGTTGAGGGGGTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 2, 1: 1, 2: 4, 3: 45, 4: 454}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902490746_902490755 15 Left 902490746 1:16779006-16779028 CCAGTGGAGAAGACAAGTGGCTG 0: 2
1: 1
2: 2
3: 25
4: 193
Right 902490755 1:16779044-16779066 CTGGAGTTGAGGGGGTGATGTGG 0: 2
1: 1
2: 4
3: 45
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902490755 Original CRISPR CTGGAGTTGAGGGGGTGATG TGG Intronic
900582858 1:3417912-3417934 CGGAAGTTGAAGGGGTGGTGGGG - Exonic
900830366 1:4961021-4961043 CTGGAGATGAGGGCAGGATGTGG - Intergenic
900836259 1:5006708-5006730 GTGGAGCTCAGGTGGTGATGCGG + Intergenic
901238938 1:7681815-7681837 CTGGAGCTGAGGGGATGGGGCGG + Intronic
901292406 1:8134381-8134403 CTGGAGTGGAGGAGGGGGTGGGG + Intergenic
901398617 1:9000801-9000823 CTGGATTCCTGGGGGTGATGGGG - Intergenic
901643100 1:10702991-10703013 ATGGAGTTGTGGGGGTGCTATGG + Intronic
902490755 1:16779044-16779066 CTGGAGTTGAGGGGGTGATGTGG + Intronic
903302021 1:22386006-22386028 CTGGAGTAGAGGGGGGGCAGAGG - Intergenic
903352118 1:22723553-22723575 CTGGAGTTGAAAGGGTGATGAGG + Intronic
903488805 1:23711963-23711985 CTGGAGTTGAGAGAGTGTTGGGG + Intergenic
903907815 1:26697844-26697866 CCGGGGGTGAGGGGGTGAGGGGG + Intronic
904110669 1:28123613-28123635 CAGCAGTGGAGGGGGTGGTGAGG + Intergenic
904199578 1:28811331-28811353 CAGGAAGTGAGGGGGCGATGAGG - Intergenic
904452137 1:30620569-30620591 CTTGATATGAGGGGGTGATGTGG + Intergenic
904532833 1:31180639-31180661 GTGGAGTTGTGGAGGTGATGGGG + Exonic
905180232 1:36160985-36161007 CTGGGGCTGAGGGAGGGATGTGG + Intronic
905181294 1:36168621-36168643 GTGGAGTTGGAGGGGTAATGGGG + Intronic
905228415 1:36494903-36494925 CAGGAGCTGTGGGGGTGAGGGGG - Intergenic
905264374 1:36740749-36740771 CTGGACAGGAGGGGATGATGAGG - Intergenic
905448519 1:38043025-38043047 CTGCAGTGGTGGCGGTGATGAGG + Intergenic
905858929 1:41333417-41333439 CAGGAGTGGAGGGGGTGAGGGGG - Intergenic
905979634 1:42211882-42211904 CTGGAGTACTGGGGGTGAGGAGG + Intronic
906279476 1:44543326-44543348 GGGGAGGGGAGGGGGTGATGGGG + Intronic
908984291 1:69998283-69998305 CAGGTGATGAGGGAGTGATGGGG - Intronic
909418424 1:75434098-75434120 TTAGAGATGAGAGGGTGATGTGG - Intronic
909897359 1:81089315-81089337 CGGGGGTTGTGGGGGTGGTGGGG - Intergenic
910206842 1:84756729-84756751 CTAGTATTGAGGGGGTGAGGGGG + Intergenic
910844652 1:91593443-91593465 GTGGAGTTGTGGGGGTGAGATGG + Intergenic
911643942 1:100319077-100319099 CTGGAGATGTTTGGGTGATGGGG + Intergenic
911720503 1:101186375-101186397 CAGGTGTTGAGGGGGAGACGTGG + Intergenic
914840923 1:151248085-151248107 CTGGAGTGGAGGGGATGCTGCGG - Intronic
914899883 1:151706267-151706289 CTGCTGTTGAGGTGGTGGTGGGG + Exonic
916058849 1:161085497-161085519 CTGGAGTTGAGGCTGTGATTTGG - Intronic
916275534 1:162989528-162989550 CTGAATTTGGGGTGGTGATGAGG - Intergenic
916825065 1:168435178-168435200 CTGGAATTGAGGGGTGAATGTGG + Intergenic
917218444 1:172702273-172702295 CTGGAGTGGAGTGGGGGATGAGG + Intergenic
918439859 1:184556058-184556080 TTGGGGTTGGGGGGGTGGTGAGG - Intronic
919605888 1:199683364-199683386 CTGGGGCAGAGGTGGTGATGGGG + Intergenic
920088591 1:203435882-203435904 CTGGAGTTGGGGGCGGGGTGGGG - Intergenic
920738013 1:208552898-208552920 CTGGAGTTGTGGAGGAGCTGAGG + Intergenic
920850386 1:209624384-209624406 CTGGAGCTGAGTGGGAGGTGTGG - Intronic
921055775 1:211541437-211541459 CTGGAGTGGAGGGGGTGATGTGG - Intergenic
922218932 1:223543276-223543298 CTGGAGGGGAGGGGGTGGTAGGG - Intronic
922466632 1:225849157-225849179 CTGGAGTTGAGGGGTGGGGGTGG - Intronic
922792316 1:228317236-228317258 GGGGAGCTGAGGGGGAGATGGGG - Intronic
923529689 1:234803491-234803513 CTGGAGTTGAGGGGGTGATGTGG - Intergenic
923924070 1:238603351-238603373 CTGGGGTAGTGAGGGTGATGGGG + Intergenic
924792278 1:247262869-247262891 CAGGAGTTGATGGGATCATGGGG + Intergenic
924905347 1:248446314-248446336 CTGGAGCCCAGGGGGAGATGTGG + Intergenic
924922542 1:248645737-248645759 CTGGAGCCTAGGGGGAGATGTGG - Intergenic
1062830764 10:603994-604016 GTGGTGTTGTGGGGCTGATGAGG - Intronic
1063345021 10:5303667-5303689 TTGGAGTTGATGAGGTCATGAGG + Intergenic
1063607473 10:7535372-7535394 CTGGAGTTGAGTGAGGGAAGTGG - Intergenic
1064118515 10:12599363-12599385 CTGGAGCTGGAGGGGTGGTGTGG + Intronic
1064119915 10:12609649-12609671 GTGGAGCTCAGGCGGTGATGCGG + Intronic
1064334101 10:14423003-14423025 ATGGAGTTGAGGGAGTAAGGAGG - Intronic
1065750112 10:28878272-28878294 CTTGAGTTAAGGCGGAGATGAGG + Intronic
1067228816 10:44392724-44392746 CTGGTGTGGAGGGGGTGAAGGGG - Intergenic
1067267391 10:44757491-44757513 ATGGAGGTGAGAGGGGGATGGGG - Intergenic
1070163709 10:73881937-73881959 ATGGAGGGGAGGGGGTGAAGAGG + Intergenic
1070380173 10:75874064-75874086 CTGGGGGTGAGGGTGGGATGTGG - Intronic
1070392368 10:75982459-75982481 GTGGAGTTGTGGGGGTTGTGTGG + Intronic
1070670123 10:78371942-78371964 CTAGAGTTGACGGGGTACTGAGG + Intergenic
1071548286 10:86545310-86545332 CTGTGGTGGAGGGGGTGGTGGGG + Intergenic
1072731649 10:97850401-97850423 CGGGAGTTGGGGGTGGGATGGGG + Intronic
1072763917 10:98080835-98080857 CTGGAGGTGAGGGGGCTGTGGGG + Intergenic
1074324378 10:112434225-112434247 CTTGAGTTGAGGGGGAGTTAAGG + Intronic
1075005476 10:118827102-118827124 CTGGTGTTGAGGGGATGCTCTGG + Intergenic
1075122954 10:119677596-119677618 CTGGACTGGAGGGGTAGATGGGG + Exonic
1075917677 10:126183304-126183326 ATGGGGTTGAGGGGGTGGTTTGG - Intronic
1076404341 10:130201977-130201999 GTGGATCTGAGGGGGTGAGGGGG + Intergenic
1076685199 10:132195534-132195556 CTGGAGGTGGGGGCGGGATGGGG + Intronic
1076732352 10:132445038-132445060 CTGCAGTTGTGGGGGTGGGGGGG + Intronic
1077007977 11:368153-368175 CAGGAGATGAGGAGCTGATGGGG + Intergenic
1077382349 11:2250064-2250086 CTGGTGTGGAGGGTGGGATGGGG - Intergenic
1077441165 11:2569929-2569951 GTGGAGTTGAGGAGGTGTTGGGG + Intronic
1077836440 11:5931192-5931214 CTGGACATGAAGGGATGATGAGG - Intronic
1078604468 11:12762933-12762955 CTGGATTTGATGGGGTGAGAAGG + Intronic
1079000413 11:16749730-16749752 TTGGAGCTGAGGTGGTAATGGGG + Intronic
1080069992 11:28070941-28070963 GTGGGGTGGAGGGGCTGATGTGG + Intronic
1083242906 11:61403058-61403080 CTGAAGTGGAGGTGGGGATGGGG + Exonic
1083655544 11:64227468-64227490 CTGGCCTTGAGGGTCTGATGTGG - Intronic
1083983358 11:66192507-66192529 CTGGAGCTGAGGGAGGGCTGTGG + Intronic
1084111262 11:67015453-67015475 CTGGTGTGGAGGCGGTGGTGGGG + Intronic
1084768882 11:71329899-71329921 CTGGAGCTGAGCAAGTGATGGGG - Intergenic
1084970845 11:72771296-72771318 GTGGAGTTCAGGGGATGTTGGGG + Intronic
1085018312 11:73189645-73189667 CTGGAGATGAGGGGAGGATTTGG - Intergenic
1085130524 11:74034085-74034107 TTCGAGAGGAGGGGGTGATGGGG + Exonic
1085376609 11:76068252-76068274 CTAGAGTTGAGAGTCTGATGAGG - Intronic
1085519913 11:77131685-77131707 CAGGAGAGGAGGGGGTGGTGAGG - Intronic
1086985264 11:93241369-93241391 CTGGAGTTGACCGGGTGAGGTGG + Intergenic
1088894549 11:114067910-114067932 CTGGAGTTTTGAGGGTGAGGGGG - Intronic
1088922341 11:114269714-114269736 CTGGAGGTGAGAGGGTGGTGAGG - Intronic
1089215566 11:116832640-116832662 GTGAAGTTGAGAGGGTGGTGTGG + Intronic
1089392415 11:118111200-118111222 CAGGAGTTCCGGGGGTGGTGAGG + Intronic
1089412933 11:118262466-118262488 CTGATGTTGATGGGGTGATAGGG - Exonic
1090663049 11:128895378-128895400 CTGGGGTTGGGGGGGGGGTGGGG - Intronic
1090708216 11:129359458-129359480 CTGGAGTTGGGGGGGTGGTGGGG - Intergenic
1090934975 11:131333217-131333239 CTGAAGTTGTGGCTGTGATGTGG - Intergenic
1091636247 12:2199121-2199143 GGGGAGTTGAGGGGATGGTGTGG - Intronic
1094415332 12:30209755-30209777 CTGCAGATGAGGGGGAGAGGTGG + Intergenic
1095577436 12:43757007-43757029 CTGGAGTATAGTGGGTAATGGGG - Intronic
1095715199 12:45337640-45337662 CTGGAGGTGAGAGGATGTTGGGG + Intronic
1096772823 12:53947010-53947032 CTGGAGTTGGGGCTGGGATGGGG + Intergenic
1096996428 12:55841059-55841081 AGGGAGAGGAGGGGGTGATGTGG - Intronic
1098193835 12:67978429-67978451 CTGGTGTGGAGAGGGTGGTGTGG + Intergenic
1098198179 12:68024430-68024452 CTGGAGTTGAGTGAATGATGGGG - Intergenic
1100001583 12:89843434-89843456 CTGTAGCTGAGGAGGTGAGGAGG - Intergenic
1100233636 12:92635314-92635336 CTGGAGATTAGGGGATGAGGAGG + Intergenic
1101989470 12:109473128-109473150 CTGGAGTTGAGTCAGTGACGGGG + Intronic
1102454995 12:113065651-113065673 CTGGAGTAGGGGAGGTGATGCGG + Intronic
1102702030 12:114847702-114847724 CAGGAGTTGGGGGGGTGGCGGGG + Intergenic
1102924071 12:116813449-116813471 CTGAGGGTGATGGGGTGATGAGG - Intronic
1102998071 12:117364863-117364885 CTGGGGTTCAGGGGGAGATGAGG + Intronic
1103934275 12:124467159-124467181 ATGCAGGTGATGGGGTGATGAGG - Intronic
1103934462 12:124467957-124467979 ATGAGGATGAGGGGGTGATGAGG - Intronic
1103934641 12:124468698-124468720 ATGAGGATGAGGGGGTGATGAGG - Intronic
1104728782 12:131093881-131093903 GTGGAGCTGTGGTGGTGATGAGG + Intronic
1104835367 12:131786711-131786733 CTGGGGGTGGGGGGGTGGTGGGG - Intronic
1104899041 12:132178336-132178358 CTGGAGTGCAGGGGGTGGGGGGG - Intergenic
1104939015 12:132386216-132386238 TTGGAGCTAAGGGGGTGTTGGGG + Intergenic
1105007278 12:132729404-132729426 GGGGAGGTGAGGGGGAGATGAGG + Intronic
1105293819 13:19071543-19071565 CAGGTGGTGAGGGGGTGCTGCGG - Intergenic
1105974687 13:25463050-25463072 CTGGCGTTGGGAGGATGATGAGG + Intronic
1106582348 13:31029092-31029114 TTGGAGTTGATGAGGTCATGAGG - Intergenic
1106612722 13:31299100-31299122 CTGGAGAAGAAGGGGTGAAGAGG - Intronic
1107443583 13:40449852-40449874 CTGGAGTGGAAGGGGTGGTGAGG + Intergenic
1107516835 13:41137587-41137609 TTGGGGTTGAGGGGGGCATGTGG - Intergenic
1107773342 13:43811605-43811627 CTGGAGGGGAGGAGGGGATGTGG + Intergenic
1110352539 13:74526041-74526063 CTGGATTTTTGGGGGTGAGGAGG + Intergenic
1110425034 13:75357473-75357495 CTGGAGTTGGGGAGGTGAGAAGG - Intronic
1111976060 13:94968191-94968213 CTGGGGTGGAGGGGAGGATGGGG - Intergenic
1112117187 13:96369062-96369084 CTGGTGTTGTGGGGGTGGGGAGG + Intronic
1112246930 13:97743803-97743825 GTGGAGATGATGGGGTCATGGGG - Intergenic
1112857402 13:103787957-103787979 TTGGAGATGAGGGGATGATATGG - Intergenic
1113677265 13:112215340-112215362 CTGGAGTGGGGAGGGAGATGGGG + Intergenic
1114062987 14:19037493-19037515 CTGGAGTTCACGGCGTGGTGGGG + Intergenic
1114099272 14:19362504-19362526 CTGGAGTTCACGGCGTGGTGGGG - Intergenic
1115310620 14:31974824-31974846 ATGGAGGTGGGGGGGTGCTGAGG - Intergenic
1117042589 14:51780365-51780387 CGCGAGTGGCGGGGGTGATGCGG + Intergenic
1117184801 14:53228877-53228899 CTGGCTTTGTGGGGGAGATGGGG - Intergenic
1117694376 14:58344108-58344130 TGTGAGATGAGGGGGTGATGAGG + Intronic
1117973083 14:61271399-61271421 CTGGAGTTGAAGGCGTGAGAAGG - Intronic
1118054185 14:62062289-62062311 CTCTATTTGAGGGGGGGATGAGG + Intronic
1118928065 14:70212217-70212239 ATGGCCTTTAGGGGGTGATGAGG + Intergenic
1119543318 14:75454804-75454826 TTGGAGTTGAGGGGTAGAGGAGG + Intronic
1119949357 14:78728595-78728617 CTGGATTTGTGGGGGCGGTGGGG + Intronic
1121050270 14:90815808-90815830 TTGGAGGTGATGGGGTGAGGGGG - Intronic
1121076180 14:91070241-91070263 TTGGAGATGAGGGGGTGAAGGGG + Intronic
1121407054 14:93725450-93725472 GTGGAGTTGGGGGGGTGCAGAGG - Intronic
1121823849 14:96994223-96994245 CTGGAGCTGGTGGGGAGATGGGG + Intergenic
1122244946 14:100395826-100395848 CTGGAGGTGAGGGGTGGGTGGGG - Intronic
1122409476 14:101518548-101518570 CTGGGGTTCAAGGGCTGATGGGG + Intergenic
1122606189 14:102948563-102948585 GTGGAGATGAGGGGGTGGGGTGG + Intronic
1122884944 14:104706801-104706823 TGGGAATAGAGGGGGTGATGGGG + Intronic
1122907523 14:104808586-104808608 CTGGAGGTGAAGGGGTGTTGAGG - Intergenic
1123493561 15:20800692-20800714 CTGGAGTTCACGGTGTGGTGGGG - Intergenic
1123550069 15:21369794-21369816 CTGGAGTTCACGGTGTGGTGGGG - Intergenic
1123948815 15:25251695-25251717 CTGGGGTTGAGTCGTTGATGGGG + Intergenic
1124606554 15:31173658-31173680 CTGGAATTGAGTGGGAGAAGAGG - Intergenic
1126689559 15:51278691-51278713 CTGGGGTTCAGGGGGTGCTTGGG + Intronic
1126800500 15:52293473-52293495 CAGGGGTTGAAGGGGTGAGGGGG - Intronic
1127780851 15:62314226-62314248 CTGGATTTGGGGGTGTGAAGAGG + Intergenic
1127886981 15:63210110-63210132 CTGTAGTTGTGGTGGTGAAGTGG + Intronic
1128812986 15:70585638-70585660 CTGGGGTCGAGGGGGGGAGGGGG - Intergenic
1129775991 15:78236827-78236849 CTGGACGTGAGAAGGTGATGGGG + Intronic
1129786548 15:78313812-78313834 CTGGTGTTGAGGGGCGGCTGGGG - Intergenic
1130563712 15:84977953-84977975 CTGGAGCTGAGGGGGTGAAGGGG + Intergenic
1132329696 15:101003790-101003812 CTGGAGCTAAGAGGGTGATATGG - Intronic
1202958399 15_KI270727v1_random:97012-97034 CTGGAGTTCACGGTGTGGTGGGG - Intergenic
1133269062 16:4601835-4601857 GGGGAGTTGAGGGGCTGGTGGGG + Intergenic
1134182194 16:12056884-12056906 CCTGAGTTGAGGGTGTGATCAGG - Intronic
1134517915 16:14901862-14901884 TTGGAGCTGAGGGGGAGAGGTGG + Intronic
1134705584 16:16300514-16300536 TTGGAGCTGAGGGGGAGAGGTGG + Intergenic
1134879375 16:17731441-17731463 ATGGAGTGGAGGTGGAGATGGGG + Intergenic
1134961957 16:18411600-18411622 TTGGAGCTGAGGGGGAGAGGTGG - Intergenic
1134966255 16:18494199-18494221 TTGGAGCTGAGGGGGAGAGGTGG - Intronic
1135226050 16:20659164-20659186 CTGGAGTTTAAGGGGTGAGATGG - Intronic
1135727613 16:24869247-24869269 CTGGGGGTGAGGGAGTGGTGTGG - Intronic
1136159413 16:28408849-28408871 CTGGAGTTGCGTGAGTGAGGGGG - Intergenic
1136203674 16:28706445-28706467 CTGGAGTTGCGTGAGTGAGGGGG + Intronic
1136284514 16:29233265-29233287 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1137593573 16:49708790-49708812 GTGGAGCTGAGGGTGTGCTGGGG - Intronic
1137596487 16:49727476-49727498 GTGGTGTTGAGGGGGAGATTGGG - Intronic
1137687110 16:50393725-50393747 CTGGAGGGGAGGGGGTGGTGAGG + Intergenic
1138030219 16:53553864-53553886 CTGGAGGTGAGGTGGGGATGAGG + Intergenic
1138300906 16:55929132-55929154 CTGGAGGTGAGCGGGTCACGTGG + Intronic
1140043652 16:71425756-71425778 CTGGAGTCGAGGTGGGGGTGAGG - Intergenic
1140313144 16:73868206-73868228 CTTGACTTCAGAGGGTGATGTGG - Intergenic
1140862781 16:79033711-79033733 CTGGGCTTGGGGAGGTGATGAGG - Intronic
1142089549 16:88202778-88202800 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1142311479 16:89316782-89316804 CAGGAGTGGAGAGGGTGGTGAGG - Intronic
1142858808 17:2749072-2749094 CAGGGGTTGGGGGGGGGATGTGG + Intergenic
1143863794 17:9909544-9909566 CTGGAGTGGAGGGAGTGAGGAGG - Intergenic
1144092650 17:11871891-11871913 CTGGTGCTCAGGGGGTGGTGGGG - Intronic
1146626513 17:34439290-34439312 CTGGAGTTGGAGGGGAGAGGAGG + Intergenic
1147899219 17:43773052-43773074 CTGGAGTGGAGGAGGTGAGCAGG + Intronic
1149746735 17:59106424-59106446 GTGGAGGTGAGGGGGTTGTGAGG - Exonic
1151159049 17:72149563-72149585 CTTGATTTGAGGGTGTGATGAGG - Intergenic
1152277034 17:79363903-79363925 CTGGAGTGGAGTGGGTGAGGGGG - Intronic
1152856308 17:82666582-82666604 CTGGTGTCTGGGGGGTGATGGGG - Intronic
1152924775 17:83081742-83081764 CTGGAGCTGCGGGTGTGATCTGG + Intronic
1152928688 17:83099437-83099459 CAGGAGGGGAGGGGGTGTTGGGG - Intergenic
1153354708 18:4122435-4122457 CTTATTTTGAGGGGGTGATGCGG + Intronic
1155316025 18:24570913-24570935 CTGGAGGTGATGAGGTCATGGGG + Intergenic
1155505556 18:26529260-26529282 TTTGAGTGGAGGGGGAGATGCGG - Intronic
1157194056 18:45606062-45606084 CTGGAGGCGGGGAGGTGATGAGG + Intronic
1159627472 18:70711597-70711619 ATGTAGATGAGGGGTTGATGGGG - Intergenic
1159719483 18:71869780-71869802 CTGGAGTTGGGGTGGTAATTAGG - Intergenic
1160073800 18:75652314-75652336 CTGGAGATCAGTGGGGGATGGGG + Intergenic
1160986350 19:1840741-1840763 CAGAAGCGGAGGGGGTGATGTGG - Intronic
1161952912 19:7477599-7477621 CTTGGGTCGGGGGGGTGATGGGG - Intronic
1162038791 19:7956903-7956925 CTGGAGCAGAGGTGGAGATGGGG + Intergenic
1162087849 19:8259370-8259392 CTGGAGCAGAGTGGGTGAGGGGG + Intronic
1162160533 19:8711362-8711384 CTGGAGTTGCGGAGGTGAATAGG + Intergenic
1162777771 19:12990196-12990218 CGGGCTTTGAGGGAGTGATGGGG - Intergenic
1162792985 19:13072534-13072556 CTGGAGCTGGGTGGGGGATGGGG + Intronic
1163601592 19:18252307-18252329 CTGAACTTGAGGGGCTGAGGTGG + Intronic
1163677759 19:18663769-18663791 CTGGAGAAGAGGGGATGAGGGGG + Intronic
1164394248 19:27850169-27850191 CTGGGGTTTAGGGGGTGGAGTGG + Intergenic
1165315651 19:35053831-35053853 TTGGAATTCATGGGGTGATGAGG + Intronic
1165335341 19:35165945-35165967 CTGGAGTGCAGGGAGTGAGGGGG + Intronic
1166068038 19:40371556-40371578 CTGGGGTGGAGGGGGTACTGTGG + Intronic
1166298112 19:41898450-41898472 CTGGAGATGAGGGGGAGCCGGGG + Exonic
1166328264 19:42064464-42064486 CTGGAGATGAGGTGGGGATCGGG - Intronic
1166361040 19:42253224-42253246 CTGGAGTGGGGGAGGTGGTGGGG - Intronic
1166828869 19:45626505-45626527 CTGGAGTTAAGAGGGTGACCGGG - Intronic
1166929173 19:46291032-46291054 CTGGAGCAGAGGGGTGGATGGGG - Intergenic
1167112618 19:47471105-47471127 ATGGAGACGAGGGGGAGATGGGG + Intronic
1167604743 19:50475802-50475824 CTGGGGATGAGGGGGTTCTGGGG + Intronic
1167777649 19:51571392-51571414 CTGGCTTTGGGGGAGTGATGAGG + Exonic
1167842309 19:52131961-52131983 CTGGAGCAGAGGGAGTGAGGAGG + Intronic
1167896667 19:52587342-52587364 CTGGAGCAGAGGGAGTGAGGAGG - Intergenic
1167906110 19:52662000-52662022 CTGGAGCAGAGGGAGTGAGGAGG + Intronic
1167945110 19:52981842-52981864 CTGGAGCAGAGGGAGTGAGGAGG + Intergenic
1168570695 19:57466511-57466533 CTGGAGTTGGGGGAGGGGTGTGG + Intronic
925326258 2:3024265-3024287 TTGGAGTTGAGGGGATGGTATGG - Intergenic
926179542 2:10629117-10629139 CTGGAGGTGGAGGGGTGGTGGGG - Intronic
926240219 2:11079689-11079711 CTGGTTTTGAGGGAGTGGTGAGG - Intergenic
928057974 2:28077699-28077721 GTGGAGTTGAGGGAGTGAGAGGG - Intronic
928537845 2:32257661-32257683 CTGGGGTGGAGGTGGAGATGAGG + Intronic
929481659 2:42313886-42313908 CTGGAGTGGATGGAGTGGTGTGG - Intronic
929531231 2:42754366-42754388 CTGGAGGGGTGGGGGTCATGGGG - Exonic
929813823 2:45214598-45214620 CTGCAGTTCATGGGCTGATGAGG + Intergenic
930188059 2:48429653-48429675 AAGGAGTTGTGGAGGTGATGGGG + Intergenic
930992934 2:57682608-57682630 TGGGGGTTGCGGGGGTGATGAGG - Intergenic
931379145 2:61736024-61736046 TTGGAGTTGAGGGGGAAAGGAGG - Intergenic
932034514 2:68229130-68229152 CTGTAGTTGAGTGGATGAGGTGG - Intronic
932364610 2:71141536-71141558 CTGGATGTGAGGGGTTGAGGGGG + Intronic
933124433 2:78586547-78586569 CTGGAGCAGAGGGAGTGAGGAGG + Intergenic
933183776 2:79256267-79256289 TTGGAGTTGTCGGGGTGAGGTGG - Intronic
933948726 2:87310071-87310093 ATGGAGTAGAGTGGGTGAGGGGG - Intergenic
934512306 2:94955123-94955145 CTAGTGGTGAGGAGGTGATGTGG + Intergenic
934574193 2:95390163-95390185 CTGATGGTGATGGGGTGATGCGG + Intergenic
934584211 2:95475533-95475555 CTGGAGTAGAGGGGGGGAAGGGG - Intergenic
934595241 2:95601181-95601203 CTGGAGTAGAGGGGGGGAAGGGG + Intergenic
934787527 2:97024353-97024375 CTGGAGTAGAGGGGGGGAAGGGG - Intergenic
935202121 2:100866170-100866192 GAGGAGTTGAGGGGGTGATGGGG + Intronic
936331472 2:111551525-111551547 ATGGAGTAGAGTGGGTGAGGGGG + Intergenic
937109096 2:119348872-119348894 CTGTAGTTGCGGGGCTGAGGTGG + Intronic
937757372 2:125556652-125556674 CTGGAGGTGATGGGATCATGGGG + Intergenic
938312327 2:130301450-130301472 CTGCAGTGGTGGGGGTGGTGTGG + Intergenic
938480346 2:131657653-131657675 CTGGAGTTCACGGCGTGTTGGGG + Intergenic
939802447 2:146726886-146726908 CTGGAGGTTAGGGAGTGATATGG + Intergenic
939956240 2:148529893-148529915 CTGGAGTTGAGGTTCTGGTGCGG - Intergenic
941516772 2:166490252-166490274 CTGGGGATGAGGGGGTGAATGGG - Intronic
942418151 2:175780447-175780469 CTGGAGTTGGGGGGTGGATGGGG - Intergenic
943811738 2:192195720-192195742 CTGGAGAGGAGCGGGTGATGAGG - Intergenic
944011836 2:194983108-194983130 CTGGAGGCCTGGGGGTGATGAGG - Intergenic
944524864 2:200608755-200608777 TAGCAGTTGAGGGGGTGGTGTGG - Intronic
945163210 2:206914341-206914363 CTGGAGGTGAGGAGGAGGTGGGG + Intergenic
946079973 2:217109476-217109498 GGGGAGTGGAGGTGGTGATGGGG + Intergenic
947169976 2:227300974-227300996 CTGGAGCTGAGGTGGGAATGAGG + Intronic
948258230 2:236584005-236584027 CTGCAGTGGAGGGGGTGGGGAGG + Intergenic
948329649 2:237155070-237155092 ATGGAGCTGAGGGACTGATGGGG - Intergenic
948455543 2:238102913-238102935 CTGGAGCTAAGGGGGTGTGGGGG - Intronic
948990668 2:241552329-241552351 CTGGAGTGCAGGGCGTGCTGCGG - Intergenic
1169329751 20:4706939-4706961 CTGGGGTTGTGTGGGTGAGGTGG + Intergenic
1170400216 20:15974504-15974526 CAGGAGTTGTGGGGGTGGGGAGG + Intronic
1170422945 20:16210615-16210637 CTGGAGTACAGGGAGTGAAGGGG - Intergenic
1171249865 20:23638731-23638753 ATGGAGCTGAGGGGGTGGAGTGG - Intergenic
1172176129 20:32972864-32972886 CTAGAGATGAGTGGGGGATGGGG + Intergenic
1172281827 20:33713242-33713264 CTGGAGCAGAGGGGCTGAAGGGG - Intronic
1172944759 20:38678482-38678504 CTGGAGAGGAGAGGGTGCTGAGG - Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173559422 20:43992206-43992228 CTGGAGTGGAGGCAGTGAGGTGG + Intronic
1173919065 20:46730441-46730463 CTGAAGTAGAGTGGGTGGTGAGG + Intronic
1173958360 20:47052258-47052280 CTGGAGTTGGGGGGAGCATGGGG + Intronic
1173985703 20:47259840-47259862 ATGACTTTGAGGGGGTGATGGGG - Intronic
1174101178 20:48127321-48127343 CTGGAGCTGAGCGGGTGGAGAGG - Intergenic
1174232122 20:49054157-49054179 CTGGATTAGAGGGAGTGATTAGG + Intronic
1174392300 20:50225202-50225224 CTGGAGTAGAATGGGTGAAGGGG + Intergenic
1174691409 20:52510257-52510279 CTGGGGGTGTGGGGGTGGTGAGG - Intergenic
1175007448 20:55700482-55700504 CTGGAGAGGAGAGGGAGATGTGG - Intergenic
1175327220 20:58138071-58138093 ATGGGGTACAGGGGGTGATGAGG - Intergenic
1175499997 20:59442983-59443005 CTGGAGCTGAGGGGGAGTCGGGG - Intergenic
1175638147 20:60602673-60602695 CTGGAGTGCTGGGGGTGAAGGGG + Intergenic
1175764953 20:61585930-61585952 ATGGTGATGAGGTGGTGATGAGG + Intronic
1176149156 20:63580544-63580566 CTTGAGTGGAGGAGGTGATAGGG - Intergenic
1176375747 21:6086176-6086198 CTGGAGTGGAGGGGAGGATAGGG + Intergenic
1177807924 21:25893231-25893253 TGGGAGTTGAGGGGGTGGAGTGG - Intronic
1178504839 21:33153965-33153987 CAGGAGCTGGGGGTGTGATGCGG - Intergenic
1178851953 21:36219921-36219943 CAGGAGTCCAGGGGGTGTTGGGG + Intronic
1178931908 21:36826592-36826614 TTGGAGATGAGGGGGATATGTGG - Intronic
1179407319 21:41136655-41136677 AGGGAGGTGAGGGGGGGATGAGG + Intergenic
1179452440 21:41475299-41475321 AAGGGGTTGAGGGGGTGAGGGGG + Intronic
1179747727 21:43452068-43452090 CTGGAGTGGAGGGGAGGATAGGG - Intergenic
1180047839 21:45318045-45318067 CTGGAGTTGGGGACGTGAGGAGG + Intergenic
1180481480 22:15760120-15760142 CTGGAGTTCACGGCGTGGTGGGG + Intergenic
1181039229 22:20184122-20184144 CTGGAGTTCACGGGGTACTGTGG - Intergenic
1181999566 22:26909195-26909217 CTGGACCTGTGGGGGTGATTAGG - Intergenic
1182079446 22:27518685-27518707 CTGGAGTAGGGGAGGGGATGGGG - Intergenic
1182087391 22:27570730-27570752 CTGGAGTGGAGTGGGTAAAGGGG - Intergenic
1182307524 22:29381001-29381023 CTGGAGCTGAGGGAATGATGGGG - Intronic
1182421496 22:30250751-30250773 CCGGGGTTGGGGGGGGGATGCGG + Intergenic
1182944859 22:34312347-34312369 CTGGAGATGAAGGGGAGAAGGGG - Intergenic
1184367902 22:44064078-44064100 CTGGTGTTGGGGTGGTGCTGGGG + Intronic
1184666960 22:45994392-45994414 ATGGAAGTGATGGGGTGATGGGG + Intergenic
1184755782 22:46515042-46515064 CTGAAGCTGAGGGGGTGCTGGGG - Intronic
1184826811 22:46958014-46958036 CGGGGGTTGGGGGAGTGATGGGG + Intronic
1184895034 22:47401719-47401741 CTGGACTTGAGGGGCTGTAGAGG - Intergenic
1185313552 22:50169659-50169681 CTGCAGGAGCGGGGGTGATGGGG + Intergenic
949133711 3:536590-536612 CTGGGGTTGCGGGCGTGAGGTGG - Intergenic
949757593 3:7430999-7431021 CTGGACTTGAGGGAGTTGTGGGG + Intronic
949843815 3:8350678-8350700 CTGGAGTTGGGGGGGTGCATGGG - Intergenic
950089441 3:10285032-10285054 CTGGAGTTGAGGGAATGTTTGGG + Intronic
950371013 3:12530593-12530615 CTGGAGGTGAGGTGGGGCTGAGG + Intronic
950704917 3:14773588-14773610 AGGGAGTTAAGAGGGTGATGGGG + Intergenic
950758469 3:15198384-15198406 CTGGAGTTATGGGGGTGACAAGG - Intergenic
950962548 3:17120921-17120943 CTGGAGTGCAGGGCGTGATCTGG + Intergenic
951633858 3:24751708-24751730 CTGGAGTTGGGTGAGTCATGGGG + Intergenic
952253752 3:31678157-31678179 CTGAACTTGAGAGAGTGATGAGG - Intronic
953335633 3:42091753-42091775 CGGGAGATGGGGGGGTGGTGAGG - Intronic
954428050 3:50453984-50454006 CGGGTGTGGAGGGGGAGATGGGG - Intronic
954468661 3:50673963-50673985 CTGGAGGTGAGGGGCTGAGCTGG + Intergenic
954966645 3:54617391-54617413 CTGAACTTGAGGGTGTGGTGGGG - Intronic
956051085 3:65249213-65249235 CTGTAGTTGAGGGAGTGGTGTGG - Intergenic
956405388 3:68923485-68923507 TTGGAGTTGTGGGGGAGAGGTGG - Intronic
960369371 3:116815066-116815088 TTAGAATTGATGGGGTGATGAGG - Intronic
960798568 3:121514473-121514495 GGGGAGTGGAAGGGGTGATGAGG - Intronic
961156910 3:124687321-124687343 CTGGAGGTGGGGGGCTGAGGAGG - Intronic
961243013 3:125428746-125428768 CTGGTGTTGAGGGGGTGCACAGG - Intergenic
961492211 3:127263874-127263896 CTGGAGGTGAGGGGGGGACCTGG - Intergenic
962198294 3:133381199-133381221 CTGGGGTTGAGCCAGTGATGTGG - Intronic
962837490 3:139202312-139202334 CTGAGGCTGAGGGGGTGTTGAGG - Intronic
964777486 3:160294080-160294102 TTGAACTTGAGGGGCTGATGGGG + Intronic
967873107 3:194248606-194248628 TGGGAGCTGCGGGGGTGATGTGG + Intergenic
968648000 4:1749443-1749465 CTGGTGGGGAGGGGGTGGTGAGG - Intergenic
968948584 4:3678569-3678591 GAGGAGTTGAGGAGGTGAGGAGG + Intergenic
969224906 4:5789447-5789469 CTGGAGTGCTGGGGGTGAGGGGG - Intronic
969692376 4:8710699-8710721 CAGGAGTTGAGGGGTTGGAGGGG - Intergenic
971489370 4:27194831-27194853 CTGGAGCAGAGTGGGTGAAGGGG + Intergenic
972705482 4:41538720-41538742 ATGGTGTTGTGGGGGAGATGTGG + Intronic
973588357 4:52414512-52414534 CTGGATTGGAGGGGTTGCTGTGG - Intergenic
974047200 4:56908120-56908142 CTGGAGTTTCGGGGGAGAGGTGG - Exonic
974630405 4:64480598-64480620 CTGGGGTTAAGGGAGGGATGAGG + Intergenic
977223623 4:94368953-94368975 CTGGAGGATAGGGTGTGATGAGG - Intergenic
977966285 4:103152799-103152821 CTGGCGGGGAGGAGGTGATGAGG + Intronic
978784205 4:112591544-112591566 CAGGAGGTAAGGGGCTGATGAGG - Intronic
979594392 4:122518151-122518173 GGGGAGTTGAGGGGGAGGTGGGG - Intergenic
980091490 4:128447602-128447624 CAGAAGCTGAGGGGGTGGTGTGG + Intergenic
980296559 4:130925888-130925910 CTGGATTTTAGGAGGGGATGAGG + Intergenic
980674879 4:136065192-136065214 CTAGAGGTGAGAGGGTGAAGAGG - Intergenic
981506988 4:145513021-145513043 ATGGAGTTGAGGGCCTGCTGAGG - Intronic
982066423 4:151658441-151658463 CTGGAGTGATGGAGGTGATGGGG + Intronic
982302048 4:153889611-153889633 CTGGAGGTGAGGTGGAGATGGGG - Intergenic
983550398 4:169011270-169011292 CTGGATTTGAGGGCTGGATGAGG + Intergenic
984102317 4:175500089-175500111 TGGCAGGTGAGGGGGTGATGTGG + Intergenic
984376607 4:178938613-178938635 GCCGAGTTGAGGGGGTCATGAGG + Intergenic
984905434 4:184621574-184621596 CTGAAGTTGTGGGGGTCTTGTGG + Intergenic
985647177 5:1090426-1090448 CTGGAGAGGAGAGGGTGACGGGG + Intronic
985680341 5:1252785-1252807 CTGGGGTGGCAGGGGTGATGGGG - Intergenic
987544723 5:19298970-19298992 CAGGAGTTGAAGGAGTGATGTGG - Intergenic
988206835 5:28147993-28148015 CTGGAGATGATTAGGTGATGAGG - Intergenic
990760837 5:59127618-59127640 CTGGAGTGTGGGGGGTGAGGTGG - Intronic
996606459 5:125328965-125328987 CTGGACTTGAGGTGATGCTGTGG - Intergenic
997523840 5:134540034-134540056 CTGGAGGTGAGGTGGAGGTGGGG + Intronic
998130551 5:139649273-139649295 CTGGAGTAGTGGGGGGGAGGGGG - Intronic
998217770 5:140250262-140250284 CTGGAGCTGAAGGAGTGACGGGG - Intronic
1000369365 5:160520081-160520103 CTGGGGTGGTGGGGGTGATGAGG - Intergenic
1001088596 5:168720363-168720385 TTGGGGTGGTGGGGGTGATGGGG - Intronic
1002054353 5:176590169-176590191 GTGGGGTTGAGGGGGAGAAGCGG + Intronic
1002457063 5:179351259-179351281 CTGGGGTAGAGGGGGTGGTAGGG - Intergenic
1002843744 6:927439-927461 GTGGAGCTGAGGGGTTGAAGGGG + Intergenic
1002941044 6:1716554-1716576 TTGGAGGTGAGGCGGTGAAGAGG + Intronic
1003653962 6:7988421-7988443 CTGGAGTGGAGGGGATGCTGTGG - Intronic
1003834111 6:10049209-10049231 CTGGATGTGAGGGGATGATGAGG + Intronic
1005959709 6:30686524-30686546 CGGGACCTGAGGGGGTGTTGGGG + Exonic
1006112664 6:31758102-31758124 CTCGGGTTGAGGTGGTGATAGGG - Intronic
1006328615 6:33373189-33373211 GAGGATTTTAGGGGGTGATGGGG - Intergenic
1006452713 6:34114420-34114442 CTGAAGCTGAGAGAGTGATGAGG - Intronic
1006453782 6:34120654-34120676 CTGGGGCTTAGGGGGTGATGTGG - Intronic
1006923387 6:37640698-37640720 TTGGAGCTGATGGGGTGCTGAGG + Intronic
1007088128 6:39165001-39165023 CTGGAGATGAGGGGCTGCTCTGG + Intergenic
1008602466 6:53109500-53109522 CTGGATTGGTAGGGGTGATGGGG + Intergenic
1009848141 6:69160336-69160358 CTTGAGTTGAGTGAGTGAAGGGG - Intronic
1011228662 6:85135695-85135717 CTGAAATTGAGGGGAAGATGAGG + Intergenic
1011630159 6:89315337-89315359 CCGGAGTGGAGGGGGTGAGTGGG - Intergenic
1011670652 6:89680026-89680048 CTGCAGTTGGGGGGTAGATGGGG + Intronic
1012157227 6:95834603-95834625 CTGAAGTTGAGAGGGTAAAGAGG + Intergenic
1012170880 6:96015842-96015864 CCAGAGTTGAGGGGGTGGGGAGG - Intergenic
1012820124 6:104076442-104076464 CTGGGGAGGAGGGGGTGATATGG + Intergenic
1012940585 6:105410429-105410451 CTGGAACTGAGGGTGTGGTGAGG - Intergenic
1013251607 6:108340022-108340044 CTGGGGTGGAGGGGGAGGTGGGG - Intronic
1013476447 6:110511395-110511417 CTGAAGTTGAGGCGGTTTTGTGG + Intergenic
1015206869 6:130650302-130650324 CTAGGCTTGAAGGGGTGATGGGG - Intergenic
1016299995 6:142619901-142619923 ATGGAGTTGTAAGGGTGATGGGG + Intergenic
1016320835 6:142844041-142844063 CTGGAGTTGAGGGTGTTGTGTGG - Intronic
1016330032 6:142945763-142945785 CTGGAGGTGAGGGGGTGGAGAGG - Intergenic
1016737814 6:147499266-147499288 CAGGTGTTGAGGGAGGGATGTGG - Intergenic
1016769745 6:147835806-147835828 CTGGAGACAAGGAGGTGATGCGG - Intergenic
1017937288 6:159016914-159016936 GTGCATTTGGGGGGGTGATGAGG - Intergenic
1018182702 6:161238060-161238082 CTGGGGGTGGGGGGGTAATGGGG + Intronic
1019142501 6:169957249-169957271 CTGCATTTGAGGGGGTGTGGTGG + Intergenic
1019350287 7:551299-551321 CTGGAGGTGAGGAGCTGCTGGGG - Intronic
1019710845 7:2517563-2517585 CAGGAGTTGCGGGGGTGGGGCGG + Intronic
1019714050 7:2530241-2530263 CTGGAGGTCAGGGGGTGTTTTGG + Intergenic
1019908208 7:4080706-4080728 GTGGCGTTGAGGGGGTGGGGAGG + Intronic
1021131621 7:16919332-16919354 CAGGGGTTGAGGGGGAAATGAGG - Intergenic
1021313442 7:19118129-19118151 CTGGGGCTGGGGGGGTGGTGTGG + Intergenic
1021632971 7:22664919-22664941 CAGGAGTTGAGGGGGAAGTGGGG + Intergenic
1022370491 7:29766497-29766519 CTGGAGGTGAGGAGGAGAAGGGG - Intergenic
1022876055 7:34531557-34531579 CTGGAGGTGAGGGGGTATGGAGG + Intergenic
1023522287 7:41060530-41060552 CTGGAGGTGATGGGATGGTGAGG - Intergenic
1024585073 7:50835130-50835152 CTGGAGTTGCGGTGGTGGAGAGG + Intergenic
1024720605 7:52133795-52133817 CTGGGGCTGAGTGGGAGATGGGG - Intergenic
1026847365 7:73705576-73705598 CTGGAGTTGAAGGGGTGGGGGGG + Intronic
1026863886 7:73810914-73810936 TTGGGGCTGAGAGGGTGATGGGG + Intronic
1027316988 7:76991866-76991888 GTGGAGTTGAGGGGGAGGTTTGG + Intergenic
1027487668 7:78782197-78782219 CTGGAGTTGGAGGAGTGAAGAGG + Intronic
1029381793 7:100219954-100219976 CTGGACTGGAGGGGGCCATGGGG + Exonic
1029972218 7:104800800-104800822 CTGGAGTTGAGGGTGTGTGTAGG - Intronic
1030299024 7:107956730-107956752 CTGGAGCTGAGGGGGTGACAGGG + Intronic
1031330619 7:120459190-120459212 CTGGAGTTCAGGGAATGAGGGGG - Intronic
1031896734 7:127358437-127358459 TTGGAGTGGAGGTGGGGATGTGG - Intronic
1032803764 7:135336732-135336754 CTGGAGTGCAGGGAGTGAGGAGG + Intergenic
1032939067 7:136767915-136767937 CTGGAGTCGGGGGAGAGATGGGG - Intergenic
1033030553 7:137821867-137821889 CTGAAGGTGAGGGTGTGAGGAGG + Intronic
1033059408 7:138091226-138091248 CTGGAGATGTGAGGGTGATCTGG + Intronic
1033515282 7:142099161-142099183 GTGGGGGTGAGGAGGTGATGCGG + Intronic
1033867940 7:145715035-145715057 CTGGACTTGAGTGAGTGAGGAGG - Intergenic
1034190079 7:149207247-149207269 CAGGAGGAGAGGGGGAGATGGGG + Intronic
1035990778 8:4488019-4488041 CTGGAGGTGAGTAGGTCATGAGG + Intronic
1036073331 8:5466993-5467015 CTGGAGTTGAGGGAAAGGTGTGG - Intergenic
1037413046 8:18618093-18618115 GTTAAGTTGAGGGGGTGGTGGGG - Intronic
1037842629 8:22256137-22256159 CTGGAGCTGAGGGAGTGAGAGGG + Intergenic
1037970525 8:23168542-23168564 CTGGGGATGAGGGGGTGGGGAGG + Intergenic
1039517783 8:38147812-38147834 CTGGGCTTGCAGGGGTGATGTGG - Intronic
1043043343 8:75289996-75290018 CTGGAGTTGAGTTGTTGAAGGGG + Intergenic
1044623880 8:94217544-94217566 CTGCATTTGAGGGGGTCAGGTGG - Intergenic
1045104750 8:98881357-98881379 CTGGAGTTGTGGGGGAGAGATGG + Intronic
1045392145 8:101726112-101726134 CTGGAGTGGAGGGCATGAGGTGG + Intronic
1046023091 8:108689860-108689882 ATGGAGAGGAGGGGGTGAAGTGG - Intronic
1046157972 8:110318975-110318997 CTGGGGTTGAGAGGGAGGTGGGG + Intergenic
1047212418 8:122850728-122850750 CAGGACATGAGGGGGTGTTGGGG - Intronic
1047819733 8:128505596-128505618 CAGGAGTTGAGGGGGAGAATGGG - Intergenic
1049272907 8:141705530-141705552 GTGGAGATGATGGGGAGATGGGG + Intergenic
1049272928 8:141705642-141705664 GGGGAGATGAGGGGGAGATGAGG + Intergenic
1049273337 8:141707669-141707691 CTGGGGTTGAGGGGTCCATGGGG - Intergenic
1049313505 8:141946686-141946708 CTGGAGATGAGGGCGAGAGGGGG + Intergenic
1049543210 8:143217998-143218020 GTGGTGTTGAGGGGGTGTGGGGG - Intergenic
1050229340 9:3502207-3502229 CTGGAGTGCAGTGCGTGATGTGG - Intronic
1051924226 9:22304302-22304324 CTGGAGGGGAGGGGGAAATGGGG - Intergenic
1051962854 9:22789395-22789417 ATGTAGATGAGGGGTTGATGGGG + Intergenic
1052447213 9:28578268-28578290 ATGGAGTTGAGGTGGGGAGGTGG + Intronic
1052592733 9:30519664-30519686 TTGGAATTGAGGGGGGGGTGTGG - Intergenic
1052750375 9:32483879-32483901 CTGGTGTGGTGGGGGTGATAAGG - Intronic
1056708069 9:88968701-88968723 CTGGAGTTCAGGGAGGGTTGAGG + Intergenic
1056716326 9:89033524-89033546 GTGGAGGTGATGGGGTGCTGAGG - Intronic
1057141461 9:92729007-92729029 AAGGAGGTGAGGGGGTGAGGAGG - Exonic
1059421031 9:114192526-114192548 CTGGGGTTGCTGGGGGGATGGGG + Intronic
1059750946 9:117246804-117246826 CTGGAGGTTAGGGGGTGAAATGG + Intronic
1060205429 9:121680137-121680159 CTGGAGTTGAGGGGATCTGGAGG + Intronic
1060796608 9:126516334-126516356 CTGGAGTGGTGGGGGTGGCGGGG - Intergenic
1061229402 9:129305468-129305490 CAGGAGGTGAGTGGCTGATGAGG - Intergenic
1061415201 9:130443871-130443893 ATGGGCTTGAGGGGGTGGTGGGG + Intergenic
1062024113 9:134332564-134332586 CTGGCCTGGAGGGGGTGAAGAGG + Intronic
1062031451 9:134363840-134363862 CTGGAGCTGAGGTCGGGATGAGG - Intronic
1062261687 9:135666065-135666087 CTGGAGTCGGGGCAGTGATGGGG + Intronic
1062292470 9:135803031-135803053 CTGGACTGGTGGGTGTGATGTGG - Intergenic
1186452200 X:9683178-9683200 GTGGAGGTCTGGGGGTGATGAGG - Intronic
1187372388 X:18720862-18720884 CTGAAGTTGAGGAGATGAGGGGG - Intronic
1188743536 X:33814404-33814426 CGGGTGTTGAGGGAGAGATGTGG + Intergenic
1189310573 X:40014719-40014741 CGGGAATTGAGGTGGTGGTGGGG - Intergenic
1189354492 X:40300514-40300536 CAGGGGTGGTGGGGGTGATGTGG - Intergenic
1189534832 X:41924752-41924774 CCAAAGTGGAGGGGGTGATGTGG + Intergenic
1190072501 X:47290843-47290865 TTAGAGTTGAGGGGGTATTGTGG + Intergenic
1190813762 X:53909733-53909755 CTAGAGTAGAGGGAGTGAAGGGG + Intergenic
1190827534 X:54031397-54031419 CTGGAGTTGGAGGGGTGGGGCGG - Intronic
1191252485 X:58266197-58266219 CTGGACTTGTGGGGGTCGTGGGG - Intergenic
1191607973 X:63082345-63082367 ATGGAGTAGAAGGGGTAATGGGG - Intergenic
1192181166 X:68916622-68916644 CTGGAGTTGGGAGGGAGAGGGGG - Intergenic
1192292809 X:69815424-69815446 CTGGAGTTGGGGTGGGGGTGGGG + Intronic
1193872405 X:86816148-86816170 CTGGGGATGAGGTGGGGATGAGG + Intronic
1195255210 X:103083104-103083126 CTGAAGTTGAGGTGGTGAAGGGG + Intronic
1196470328 X:116016624-116016646 CTGAAGTTCAGAGAGTGATGTGG - Intergenic
1198115058 X:133536736-133536758 CTGGTGGGGAGGGGGTGCTGTGG + Intronic
1198119090 X:133574150-133574172 CTAGAGTTGAGGGGGTTAGGAGG + Intronic
1198765353 X:140074697-140074719 CTGGGGTAGAGGGGGTTTTGAGG + Intergenic
1198771711 X:140137899-140137921 CTGGGGTAGAGGGGGTTTTGAGG + Intergenic
1199118523 X:144021857-144021879 ATGGAGTGGTGGGGGTGGTGCGG + Intergenic
1200403781 Y:2787734-2787756 GCGGGGTTGAGGGGGTGTTGAGG - Intergenic
1200424900 Y:3009692-3009714 GTGGAGCTGAGGGGGTGCTGAGG - Intergenic
1201105795 Y:10762409-10762431 GTGGAGTTGATGGGGTGGAGTGG - Intergenic
1201130256 Y:10946926-10946948 GTGTAGTTGAGGGGGTGGAGTGG - Intergenic