ID: 902490900

View in Genome Browser
Species Human (GRCh38)
Location 1:16779647-16779669
Sequence AACTGGACCAGCCTTGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902490900 Original CRISPR AACTGGACCAGCCTTGGCTG TGG Intronic