ID: 902493619

View in Genome Browser
Species Human (GRCh38)
Location 1:16853981-16854003
Sequence ATCCAGTGGTAGCCTGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 2, 1: 0, 2: 6, 3: 11, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902493616_902493619 -10 Left 902493616 1:16853968-16853990 CCCAAGGACAGGAATCCAGTGGT 0: 2
1: 5
2: 3
3: 18
4: 203
Right 902493619 1:16853981-16854003 ATCCAGTGGTAGCCTGTTGGAGG 0: 2
1: 0
2: 6
3: 11
4: 131
902493614_902493619 -9 Left 902493614 1:16853967-16853989 CCCCAAGGACAGGAATCCAGTGG 0: 2
1: 5
2: 1
3: 15
4: 208
Right 902493619 1:16853981-16854003 ATCCAGTGGTAGCCTGTTGGAGG 0: 2
1: 0
2: 6
3: 11
4: 131
902493611_902493619 4 Left 902493611 1:16853954-16853976 CCATCCACGGAGACCCCAAGGAC 0: 1
1: 3
2: 3
3: 10
4: 116
Right 902493619 1:16853981-16854003 ATCCAGTGGTAGCCTGTTGGAGG 0: 2
1: 0
2: 6
3: 11
4: 131
902493613_902493619 0 Left 902493613 1:16853958-16853980 CCACGGAGACCCCAAGGACAGGA 0: 1
1: 5
2: 3
3: 10
4: 180
Right 902493619 1:16853981-16854003 ATCCAGTGGTAGCCTGTTGGAGG 0: 2
1: 0
2: 6
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902493619 Original CRISPR ATCCAGTGGTAGCCTGTTGG AGG Intronic
901905286 1:12403945-12403967 ATCCAATGGGAGCTTGTTGGAGG - Exonic
902458539 1:16553935-16553957 ATCCAGTGGTAGCCTGTTGGAGG - Intergenic
902493619 1:16853981-16854003 ATCCAGTGGTAGCCTGTTGGAGG + Intronic
903151729 1:21414694-21414716 ATCCACTGGTAGCCAGTTGGAGG - Intergenic
904404107 1:30274986-30275008 AGCCAGTGGGAGACAGTTGGGGG - Intergenic
907955378 1:59223293-59223315 ACCCAGAGGTAAGCTGTTGGAGG - Intergenic
909874756 1:80788109-80788131 AGTCAGTGGTAGCTTGATGGGGG - Intergenic
914209328 1:145563715-145563737 ATCCACTGGTAGCCGGTTGGAGG - Intergenic
914268247 1:146056083-146056105 ATCCACTGGTAGCCGGTTGGAGG - Intergenic
914368851 1:147004778-147004800 ATCCACTGGTAGCCGGTTGGAGG + Intergenic
914584088 1:149045409-149045431 ATCCACTGGTAGCTGGTCGGAGG - Intronic
915957497 1:160234025-160234047 AGCCAGTGGAAGCCAGTTTGAGG - Intronic
917965144 1:180174063-180174085 AACCAGTGTTTGGCTGTTGGAGG + Intronic
918196270 1:182225191-182225213 ACACACTGGGAGCCTGTTGGGGG + Intergenic
918837819 1:189490396-189490418 ATACAGTGGTACCCCTTTGGGGG + Intergenic
919208460 1:194449514-194449536 ATCAAGAGATAACCTGTTGGAGG + Intergenic
919987339 1:202685065-202685087 ACCCAGTGGTCGCCTGTGAGGGG + Intronic
1065035741 10:21637103-21637125 CTCCAGTGGGTGCCTGTGGGTGG + Intronic
1072025893 10:91456112-91456134 AGCCATTGGTAGCCTGATGGGGG + Intronic
1076272444 10:129166138-129166160 TTGCAGTGGTAGCCAGATGGTGG + Intergenic
1076663269 10:132069379-132069401 ATCCAGTACTATCCTGATGGTGG + Intergenic
1077449624 11:2630940-2630962 ATCCACTGATAGCCTTATGGAGG + Intronic
1077863715 11:6205629-6205651 ATCCAGTGTCAGCAGGTTGGGGG - Exonic
1078970612 11:16406497-16406519 ATCCTGGACTAGCCTGTTGGAGG - Intronic
1079465221 11:20723633-20723655 ACACAGTGGTAACCTGTTGCTGG + Intronic
1081879735 11:46438448-46438470 ATCGATTTGTAGCCTGTTGCTGG + Intronic
1082908039 11:58334049-58334071 ATCCATTGGTAGTCTAATGGAGG + Intergenic
1083518256 11:63281391-63281413 ATCCATTGGTAGCCTGATGGGGG + Intronic
1088795109 11:113261116-113261138 ATACAGCTGCAGCCTGTTGGGGG + Intronic
1091948572 12:4571921-4571943 ATCAAGTGCTAGTCTGTGGGAGG - Intronic
1092492015 12:8954016-8954038 AGCCAGTGGGAGCCTTTTAGTGG + Intronic
1095600956 12:44012938-44012960 ATGCAGTGGTAGGGTGTGGGGGG + Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1098589979 12:72199483-72199505 AACCTGTGGTAGCATGTTGAAGG + Intronic
1098634102 12:72759361-72759383 ATCCACTGTTAGTCTGATGGGGG - Intergenic
1099217047 12:79865920-79865942 ACTCAGTGGTAGCTTGATGGGGG - Intronic
1099879492 12:88450453-88450475 ATCCAGTGGTAGGCTTTTCAGGG - Intergenic
1102700440 12:114834617-114834639 ATTCAGTGGGAGCCTCATGGGGG + Intergenic
1105898299 13:24736490-24736512 AGTCTGTGCTAGCCTGTTGGAGG + Intergenic
1106106858 13:26740633-26740655 CTCCAGTGGTGGCTTTTTGGGGG - Intergenic
1107817129 13:44254304-44254326 ATCCAGTGGCAGCAGGCTGGAGG - Intergenic
1108167053 13:47704412-47704434 ATCTAGTGGTACCATGTTGCTGG + Intergenic
1109071711 13:57777812-57777834 ATCCACTGTTAGTCTGATGGGGG + Intergenic
1112425844 13:99300195-99300217 CTCCAAGGGTAGCCTGTTGAGGG + Intronic
1115753971 14:36515729-36515751 ACCCAGTGTTACCCCGTTGGAGG + Intergenic
1116146929 14:41085870-41085892 ATACAGTGGTATCTTCTTGGTGG - Intergenic
1116279656 14:42887995-42888017 AGTCAGTGGTAGCTTGATGGGGG - Intergenic
1116999603 14:51358874-51358896 AGCCAGTGGAAGCCTCTTCGAGG - Intergenic
1118661339 14:68016349-68016371 ATCTAGTTGTATCATGTTGGTGG - Intronic
1119072789 14:71604757-71604779 ATCCACTGTTAGTCTGATGGGGG + Intronic
1119132841 14:72190569-72190591 GTCCAGGTGTAGCCTGTTGAGGG - Intronic
1123916708 15:25037789-25037811 ATCCAGTGGTATCCTATTTGAGG - Intergenic
1126885389 15:53143608-53143630 AAGAAGTGGTAGTCTGTTGGCGG + Intergenic
1133607704 16:7404424-7404446 ATCCAGTGATAGCTTCTTAGAGG + Intronic
1134205727 16:12236654-12236676 AATCAGTGGTAGCCTGTGGCTGG - Intronic
1141139921 16:81490721-81490743 ATCAAGTGTTAGCCTGGTAGAGG - Intronic
1141305340 16:82857406-82857428 AACCAGTGGTTGGTTGTTGGGGG + Intronic
1141621407 16:85238402-85238424 CTGCAGCGGTAGCCTGGTGGGGG + Intergenic
1141633450 16:85301490-85301512 ATCCAGTGGCTGCCGGTTGGTGG + Intergenic
1143563265 17:7707516-7707538 ATTCAGTGGTGGCCTGAAGGAGG + Intronic
1145754789 17:27382456-27382478 ATAGAGTCCTAGCCTGTTGGTGG - Intergenic
1145845660 17:28036705-28036727 AGTCATTGGTAGCTTGTTGGGGG - Intergenic
1153885903 18:9465639-9465661 ACTCAGTTGTAGCCAGTTGGTGG - Intergenic
1155025471 18:21936369-21936391 GACCAGTGGAAGCTTGTTGGAGG - Intergenic
1155088195 18:22477689-22477711 ATCCACTGTTAGTCTGATGGGGG + Intergenic
1156343710 18:36236671-36236693 AGGCATTGGTAGCCTGATGGGGG + Intronic
1162396774 19:10421615-10421637 ATCCAGAGGGTGCCTCTTGGGGG + Intronic
1164053067 19:21599446-21599468 ATCGTGTGGTAGCAGGTTGGGGG + Intergenic
1167241611 19:48346960-48346982 ATACAGTGGGAAGCTGTTGGAGG - Intronic
1202708994 1_KI270714v1_random:6174-6196 ATCCACTGGTAGCCGGTTGGAGG + Intergenic
929838441 2:45430244-45430266 AGTCAGTGGTAGCTTGATGGGGG - Intronic
932913110 2:75825838-75825860 ATCCAGTCCTAGGCTTTTGGGGG - Intergenic
935923967 2:108047354-108047376 ATTCCTTGGTGGCCTGTTGGTGG + Intergenic
938822549 2:134974358-134974380 ATCCACTGTTAGTCTGATGGGGG + Intronic
939184124 2:138840632-138840654 ATCCAAAGGCAGCCTGCTGGAGG + Intergenic
942604896 2:177680107-177680129 ATCCAGTAGTTGCCTGGTTGTGG + Intronic
943262492 2:185683894-185683916 AGTCAGTGGTAGCTTGATGGGGG + Intergenic
944393186 2:199241138-199241160 AGTCATTGGTAGCTTGTTGGGGG + Intergenic
946487386 2:220113978-220114000 GTGCAGTGGTACCCTGTTGCTGG + Intergenic
948649335 2:239430264-239430286 GTCCAGTGCCAGGCTGTTGGGGG - Intergenic
1169000719 20:2166045-2166067 AGCCTGAGCTAGCCTGTTGGAGG + Intronic
1169511452 20:6268532-6268554 ACCCACTGGTGGTCTGTTGGAGG + Intergenic
1169541757 20:6607084-6607106 ATTCAGTGGCATCATGTTGGTGG + Intergenic
1169685421 20:8266367-8266389 ACCCAGTGCTAGCCTCTTGGAGG - Intronic
1169795499 20:9458651-9458673 AGCCTGTGCTAGCCTGCTGGAGG - Intronic
1171977899 20:31606994-31607016 ACCCAGAGGTAGGCTGTTGGGGG - Intergenic
1179945715 21:44673181-44673203 ATCCACTGTTAGTCTGATGGGGG - Intronic
1180897414 22:19346953-19346975 ATCAAATGGTAGCCTGTTTGTGG + Intronic
1181435482 22:22908019-22908041 ATCCATTGGTTGTCTGATGGAGG + Intergenic
1182011344 22:27003280-27003302 ATTAAATGGTAGCCTTTTGGAGG - Intergenic
1182313669 22:29427483-29427505 ATCCATTGGTTGTCTGATGGAGG - Intergenic
1182856417 22:33521431-33521453 AACCCGGGCTAGCCTGTTGGAGG - Intronic
1184573194 22:45340061-45340083 ATACAGTGAGAGCCTGTTGGAGG - Intronic
952813241 3:37423801-37423823 ACTCAGTGGTAGCCAGCTGGTGG - Intronic
952843330 3:37666571-37666593 ATCCTGGGCTAGCCTGCTGGAGG - Intronic
957917747 3:86708364-86708386 ATCCAGTTTTAGTCTGTTGCTGG + Intergenic
958621687 3:96570830-96570852 AGTCAGTGGTAGCTTGATGGGGG + Intergenic
960129958 3:114045297-114045319 AACCAGTGGGAGGCTGTTGGTGG - Intronic
963453337 3:145513846-145513868 AACCAGTGGTAGACTGAAGGGGG + Intergenic
963837402 3:150071017-150071039 TTCCAGTTGTTTCCTGTTGGGGG - Intergenic
966429572 3:179817141-179817163 AACCAGTTTTTGCCTGTTGGGGG + Intronic
969681442 4:8645519-8645541 ATCCAGAGGTGTCCTGTTGATGG - Intergenic
971214024 4:24647164-24647186 AGCCAGAGCTAGCCTGCTGGAGG - Intergenic
971442128 4:26698464-26698486 AGTCAGTGGTAGCTTGATGGGGG - Intronic
975611512 4:76208573-76208595 AAACAGAGGAAGCCTGTTGGTGG + Intronic
980645625 4:135638776-135638798 ATCCAGAGCTAGACTGTTGAGGG + Intergenic
981081676 4:140643822-140643844 ATGCAGAGGTGGCCCGTTGGAGG - Intronic
983131450 4:164024365-164024387 ATCTACTGTTAGCCTGATGGGGG - Intronic
983593875 4:169443802-169443824 AGCCATTGTTAGTCTGTTGGGGG - Intronic
983730684 4:170990221-170990243 ATCTATTGGCAGCCTGATGGGGG + Intergenic
988954818 5:36304731-36304753 AACCAGTGGTATCCTTTTGTGGG - Intergenic
989214919 5:38893953-38893975 GTCCACTGTTAGCCTGATGGGGG - Intronic
989261142 5:39421543-39421565 ATCCAATTGTGCCCTGTTGGAGG + Intronic
989362721 5:40622172-40622194 TTCCAGTGTAAGCCTGTTGCAGG + Intergenic
991948737 5:71927232-71927254 ATGCTGTGGTAGCCATTTGGGGG - Intergenic
992206642 5:74436818-74436840 AGTCAATGGTAGCTTGTTGGGGG - Intergenic
996980706 5:129490440-129490462 ATGCATTGGTAGCCTGCTAGGGG + Intronic
997648437 5:135497343-135497365 ATCCACTGGTGGCCTTCTGGAGG + Intergenic
1000797814 5:165687590-165687612 ACACACTGGGAGCCTGTTGGGGG - Intergenic
1001347280 5:170915755-170915777 GTACCGTGGTATCCTGTTGGGGG - Intronic
1010374090 6:75146166-75146188 GTGCAGTGGCAGCCTGTGGGAGG - Exonic
1011263801 6:85495055-85495077 ATTCAGTGCTAGCCTCTTGCTGG - Exonic
1011527925 6:88286458-88286480 ATCCACTGGTAGCCTTATGGAGG + Intergenic
1015837975 6:137442952-137442974 ATTTACTGTTAGCCTGTTGGAGG + Intergenic
1019905380 7:4058627-4058649 ATCCACTGTTAGTCTGATGGGGG - Intronic
1028830930 7:95325805-95325827 AGCCAGTGGTATTCAGTTGGTGG - Intergenic
1032053740 7:128667960-128667982 ATTAAGTGGTGCCCTGTTGGTGG + Intergenic
1034080612 7:148274585-148274607 ATCCAGAGGAAGAGTGTTGGGGG - Intronic
1036410145 8:8492367-8492389 ATCCGCTGCTAGCCTGCTGGAGG - Intergenic
1036751612 8:11447042-11447064 CTGCAGTGGGAGCCTGCTGGTGG - Intronic
1038997700 8:32944179-32944201 ATCCACTGTTAGTCTGATGGGGG + Intergenic
1044632394 8:94292259-94292281 ATCCTGTGGTAGCCTGTGTGTGG - Intergenic
1045244599 8:100431866-100431888 ATCCAGTGGAAGACTCTGGGGGG + Intergenic
1045521128 8:102904316-102904338 ATCCAGTGGTTACCTTTTGCAGG - Intronic
1048049666 8:130805514-130805536 ATTCTGTGGTATCCTGCTGGAGG + Intronic
1049056026 8:140238300-140238322 AGCCACTGTTAGCCTGTAGGTGG - Intronic
1051566499 9:18504990-18505012 AACCAGAGGTAGCCGGTTTGAGG + Intronic
1051885855 9:21891903-21891925 GTCCATTGTTAGCCTGATGGGGG - Intronic
1052958130 9:34270743-34270765 ATTAAGTGGTAGGCTGATGGTGG - Intronic
1055902867 9:81261358-81261380 AGTCAGTGGTAGCTTGATGGGGG - Intergenic
1061819473 9:133218200-133218222 ATCCAGTGCCAGCCTGGAGGTGG + Intergenic
1188155112 X:26732154-26732176 AATCAGTGGTAGCTTGATGGAGG + Intergenic
1188408792 X:29845661-29845683 ATACAGTAGTTGCGTGTTGGGGG - Intronic
1190471765 X:50787696-50787718 ATCCACTGATAGTCTTTTGGAGG - Intronic
1193594912 X:83434375-83434397 ATCCACTGTTAGTCTGATGGTGG + Intergenic
1195414634 X:104606839-104606861 AGTCAGTGGTAGCTTGATGGGGG - Intronic
1197076192 X:122356058-122356080 ATCCCTTGGTACACTGTTGGTGG + Intergenic
1197913459 X:131510952-131510974 ATCCACTATTAGCCTGATGGGGG + Intergenic
1200413192 Y:2881777-2881799 AACCACTGGTTGCCTGCTGGTGG + Intronic
1202036829 Y:20644778-20644800 CTCCCTTGGTAGCCTGTTTGAGG + Intergenic