ID: 902495261

View in Genome Browser
Species Human (GRCh38)
Location 1:16867918-16867940
Sequence AGTCACCCCCAAAAATGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902495261_902495263 8 Left 902495261 1:16867918-16867940 CCAAAACATTTTTGGGGGTGACT 0: 2
1: 0
2: 0
3: 14
4: 140
Right 902495263 1:16867949-16867971 CTCCAAAAATCTTCCATAAATGG 0: 5
1: 0
2: 2
3: 17
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902495261 Original CRISPR AGTCACCCCCAAAAATGTTT TGG (reversed) Intronic
902456908 1:16539995-16540017 AGTCACCCCCAAAAATGTTTTGG + Intergenic
902474484 1:16674260-16674282 GGTCACCCCCAGGAATGTTTTGG + Intergenic
902484320 1:16733182-16733204 GGTCACCCCCAGGAATGTTTTGG - Intergenic
902495261 1:16867918-16867940 AGTCACCCCCAAAAATGTTTTGG - Intronic
903029881 1:20456279-20456301 ACTCACTTTCAAAAATGTTTTGG + Intergenic
904325665 1:29726462-29726484 AGTCACCCCCAAAGCTGAGTTGG + Intergenic
909327100 1:74364559-74364581 CGCCACCCCCAAAGATGTTCAGG + Intronic
910243783 1:85117161-85117183 AGTTACCTGGAAAAATGTTTAGG + Intronic
911971760 1:104447524-104447546 TGTAACCCCCAAAAATATTTTGG + Intergenic
913290846 1:117270200-117270222 TGTGAGCCCCAACAATGTTTTGG + Intergenic
917941080 1:179922224-179922246 ATTCAACCCCCAAAATGGTTTGG - Intronic
917976093 1:180239567-180239589 AATCACCAGCAAAAAGGTTTTGG + Intronic
918650591 1:186957408-186957430 AATCATCCCCACAAATGTGTTGG + Intronic
919100348 1:193088960-193088982 AGTCACCCACATAGAGGTTTGGG + Intronic
920858216 1:209681322-209681344 TGTAACCACCAAAAATCTTTAGG - Intergenic
922007619 1:221548065-221548087 AGTACCCTTCAAAAATGTTTAGG + Intergenic
922197596 1:223373086-223373108 TGTCCCCCCCAAAAATTTATAGG - Intergenic
922463500 1:225830310-225830332 AGTTACCCCCAAACAGATTTTGG - Intronic
924525464 1:244843716-244843738 ATACTTCCCCAAAAATGTTTAGG - Exonic
1063091181 10:2867365-2867387 ATGCACCCCAAAAAATGTCTTGG + Intergenic
1064500090 10:15962076-15962098 ATTCACCACTAAAAATGATTTGG + Intergenic
1067200037 10:44160690-44160712 AGACACCCACAGAGATGTTTAGG + Intergenic
1069240707 10:66135381-66135403 GTTCTCCCCTAAAAATGTTTGGG + Intronic
1071789589 10:88939998-88940020 ACCCACCCCAAAAAATGTTATGG - Intronic
1074124657 10:110518605-110518627 AGTAACATCCAAAAATATTTAGG - Intergenic
1075497316 10:122934731-122934753 AGTCACTCTAAAAAATATTTTGG - Intronic
1076246949 10:128954684-128954706 AGTCACGTCCAAACATGTTATGG - Intergenic
1078494788 11:11806200-11806222 CGTGACTCCTAAAAATGTTTTGG - Intergenic
1081598099 11:44473192-44473214 AGTCACCCACATAGAGGTTTGGG + Intergenic
1087668058 11:101072857-101072879 AGTCTCCCCCATTAATGTGTGGG - Intronic
1088209962 11:107443907-107443929 AGGCACAGCCATAAATGTTTTGG - Intronic
1088691935 11:112335792-112335814 GGACACCCCAAAAAATGTCTTGG + Intergenic
1090420891 11:126574180-126574202 AGTGTCCTCCATAAATGTTTAGG - Intronic
1095192367 12:39272246-39272268 ATTCACCCAGAAAAATGTCTGGG + Intergenic
1097537116 12:60886131-60886153 AGTTACCCCCAAAAAAGTCCAGG - Intergenic
1098796966 12:74901199-74901221 AGTCTTCCCCTAAAATTTTTTGG - Intergenic
1099384125 12:81993672-81993694 TGTCAGCACCAAAAAAGTTTTGG + Intergenic
1099552483 12:84065333-84065355 GGTCACCACCAAACATCTTTGGG - Intergenic
1100666446 12:96758578-96758600 AGTCACCCCCTAATATGGTTTGG - Intronic
1104022632 12:125003545-125003567 AGGCACCCTCAAAAAAATTTAGG - Intronic
1106109652 13:26765747-26765769 AATGACCCCCAAAAATATCTAGG + Intergenic
1106726401 13:32490651-32490673 AACCACCCCCAAAAAGGTTGGGG - Intronic
1107542232 13:41401673-41401695 AGTCACCCCAAAAATATTTTAGG - Intergenic
1108632327 13:52298204-52298226 AGTGACTCACACAAATGTTTTGG + Intergenic
1108654374 13:52514390-52514412 AGTGACTCACACAAATGTTTTGG - Intergenic
1113088543 13:106593182-106593204 AGTCAACCCCACAAAAGTATGGG - Intergenic
1113870178 13:113554351-113554373 AGACACCCATAAAAATGATTGGG + Intronic
1114959376 14:27865396-27865418 AGACACCCCAACAAATTTTTAGG + Intergenic
1115346338 14:32346874-32346896 AGTAACCACCCAAAAAGTTTGGG + Intronic
1117321875 14:54632141-54632163 AGTCATCCTCTAAAATGCTTTGG - Intronic
1117858106 14:60056923-60056945 ACTAAACCCCCAAAATGTTTTGG - Intronic
1117888404 14:60390522-60390544 AGTGACTCCGAAAAATATTTTGG + Intergenic
1117931436 14:60845878-60845900 ATTGACCCCATAAAATGTTTTGG + Intronic
1118967837 14:70604671-70604693 ACTCACCCCAAAAAATGTGGGGG - Intergenic
1119540378 14:75434303-75434325 CCCCACCCCCAGAAATGTTTAGG + Intronic
1123432241 15:20228569-20228591 AGTCAGCACCAGAAATGTTCGGG + Intergenic
1124172874 15:27392354-27392376 AGTCATCCCCAAAAATGTCAGGG - Intronic
1125412103 15:39416354-39416376 AGCCAACCTGAAAAATGTTTGGG + Intergenic
1126945069 15:53810249-53810271 AGACACTCCAAAAAATGTCTGGG - Intergenic
1131797142 15:96030764-96030786 CGTCACCCCCAGAGATGTCTAGG - Intergenic
1132459100 16:41489-41511 ATGAACCCCCAGAAATGTTTCGG - Intergenic
1133662292 16:7930015-7930037 AGACATCCCCAAAAGTGTCTAGG + Intergenic
1144402923 17:14924191-14924213 AGTGACCCCTTAAAATTTTTTGG + Intergenic
1148192505 17:45689291-45689313 ACTAACCCCCAAAACTGATTTGG - Intergenic
1149422609 17:56525575-56525597 ACTCACCCCCAAAAAGACTTTGG + Intergenic
1152522790 17:80869480-80869502 AAACACCCCCAAAAATGTGGGGG + Intronic
1152607068 17:81296936-81296958 AGTCTTCCCCATAATTGTTTAGG - Intergenic
1154442125 18:14399538-14399560 AGTTACCACCAAATATGTTGGGG - Intergenic
1155827178 18:30461171-30461193 AGATACCCCAAAAAATCTTTGGG - Intergenic
1165236727 19:34428049-34428071 TGTCACCCCCAAAAAAATATAGG - Intergenic
1167512587 19:49903607-49903629 AGTAAACCCCAAAAATGTCAGGG - Intronic
1167870750 19:52368363-52368385 AGTCACCCTCACAACTCTTTTGG + Intergenic
1202707859 1_KI270713v1_random:36645-36667 GGTCACCCCCAGGAATGTTTTGG + Intergenic
926665438 2:15516920-15516942 AATCACCCTCTAGAATGTTTAGG + Intronic
927249396 2:20984101-20984123 ACTCAGCCCCAAAACTTTTTGGG + Intergenic
931066120 2:58589252-58589274 AGTAACCACCAAAAATGGTCAGG + Intergenic
933637729 2:84725724-84725746 TGTCACCTACAAATATGTTTTGG - Intronic
935103387 2:100017594-100017616 AGTCACCCCAAATAATTTTCTGG + Intronic
936170759 2:110170972-110170994 AGTCGCCCCTAAAAATGAGTAGG + Intronic
938029485 2:127980546-127980568 AGTCATGCACAAAAATGTTCAGG + Intronic
939893179 2:147761275-147761297 TGTCACCTCCAGAGATGTTTTGG - Intergenic
939909008 2:147956721-147956743 AGTTGTACCCAAAAATGTTTTGG - Intronic
942091500 2:172495835-172495857 AGCCACCCCCATAAATGGTTGGG - Intronic
942898522 2:181087250-181087272 AGTTTCCCCCAATATTGTTTAGG - Intergenic
943360640 2:186914920-186914942 AGTCACTCACAAAAATATTGAGG - Intergenic
943372392 2:187030877-187030899 AGTCATAACCAAAAATTTTTTGG - Intergenic
943953594 2:194159561-194159583 AGAGAACTCCAAAAATGTTTAGG - Intergenic
946948812 2:224850170-224850192 AGTCATCTGCAAAAAGGTTTAGG - Intronic
948029519 2:234805615-234805637 AGGTACTCCCAAAAGTGTTTGGG - Intergenic
948029719 2:234807478-234807500 AGGTACTCCCAAAAGTGTTTGGG - Intergenic
948742893 2:240059697-240059719 ACTCACACACAAAAATGTTAAGG - Intergenic
1169396108 20:5231033-5231055 TGTCACCCCCAAAATTCATTAGG + Intergenic
1170916949 20:20635669-20635691 AGTAATCCCTACAAATGTTTTGG + Intronic
1175155554 20:56968864-56968886 AATCACCCACATAAATATTTTGG + Intergenic
1179277172 21:39903011-39903033 AGTTTCCCCCAAAAATCTTTCGG - Intronic
1179835092 21:44026110-44026132 AGTCACCCCCTAAGATGACTAGG - Intronic
1185159308 22:49213276-49213298 AGGCACCCCCAAGAGTGCTTGGG - Intergenic
952530218 3:34255488-34255510 ACTCAGCCCCATAGATGTTTGGG - Intergenic
953811395 3:46115818-46115840 AGAAACCTCCAAAAATTTTTAGG - Intergenic
955872142 3:63450618-63450640 AATAACCCCCAAAGATGTTTGGG - Intronic
960372326 3:116855525-116855547 AGCCAGCCCTAAAAATGATTGGG - Intronic
963211437 3:142696510-142696532 ACCCACCCCCAAGAATTTTTAGG + Intronic
963933645 3:151030162-151030184 AGTCAACCTCAAAAATGTGAGGG + Intergenic
965292589 3:166902912-166902934 TTTCTCCCCCCAAAATGTTTAGG + Intergenic
966479212 3:180386712-180386734 AGTCACCTCAAATAATGCTTGGG + Intergenic
969889995 4:10251208-10251230 AGTCACTTTCAAAAATGGTTGGG - Intergenic
969998143 4:11336180-11336202 AGTCACTCACAAACATGTATTGG + Intergenic
973566537 4:52194451-52194473 AGTCAAACCAAAATATGTTTGGG + Intergenic
975568103 4:75781614-75781636 AGTCAGTCCCACAAATTTTTTGG - Intronic
976158280 4:82171527-82171549 AGTAACCACCAAAAATTTTAAGG - Intergenic
977112548 4:92977311-92977333 AGTCAACCACAAAAATTTCTGGG + Intronic
979496573 4:121390657-121390679 AATCATCACCAAAAATCTTTTGG + Intergenic
981020470 4:140022310-140022332 AGTTACCCCCAAAAAACTATTGG + Intronic
982233619 4:153231934-153231956 TGTCAGCACCCAAAATGTTTTGG - Intronic
992112267 5:73506774-73506796 AGTCACCCCCAATACTTCTTGGG - Intergenic
994850646 5:105051113-105051135 TCTCAGCCCCAAAACTGTTTAGG - Intergenic
994886231 5:105565097-105565119 ACTCACTCCCTAAAAAGTTTAGG - Intergenic
995982709 5:118124849-118124871 ACCCACCCCCAAAAATGTACAGG + Intergenic
996593952 5:125179983-125180005 AAGCACCCCCAAAACTGCTTGGG + Intergenic
997944563 5:138188401-138188423 AGACCCCCCCAAAACTGTTTTGG + Exonic
1001272176 5:170321518-170321540 TGTTTCCCCCAAAATTGTTTTGG - Intergenic
1001916829 5:175568950-175568972 AGTAACTTCCAAAAATGCTTGGG + Intergenic
1002326208 5:178408599-178408621 AGTCACCCTGAAAAATAGTTTGG + Intronic
1002972932 6:2042890-2042912 AAACACCCTCCAAAATGTTTAGG + Intronic
1004005964 6:11637373-11637395 AGTCACCCCCAAACCTCTCTAGG - Intergenic
1007337704 6:41166294-41166316 TCTCACCCCCAAAAATCTGTTGG + Intergenic
1008784546 6:55150916-55150938 AGTGAATCCCACAAATGTTTTGG + Intronic
1009526696 6:64756116-64756138 ACTGACCCCCAAAATTCTTTAGG + Intronic
1010848191 6:80738286-80738308 AGTCATGCACAACAATGTTTTGG - Intergenic
1015989211 6:138918419-138918441 AGTCATCCCTCAATATGTTTAGG - Intronic
1017066581 6:150534789-150534811 AGCCGCCCTCAAAATTGTTTTGG - Intergenic
1017643114 6:156513428-156513450 AGTCAATCCCAAAGATGTCTGGG + Intergenic
1018391561 6:163345276-163345298 ACACACCCCCAAAAATGTCTTGG - Intergenic
1020016684 7:4835575-4835597 AGTCATCCCCAAAACTGTGTGGG + Intronic
1026617417 7:71917967-71917989 AGTCACGACCAAATGTGTTTAGG + Intronic
1026712375 7:72753918-72753940 AGTGAGCCACACAAATGTTTTGG - Intronic
1028667972 7:93369004-93369026 AGTGAGTCACAAAAATGTTTTGG - Intergenic
1034163462 7:149008746-149008768 AGTCACCACCAAAAATTGTGTGG + Intronic
1038577673 8:28718710-28718732 AGTCACCTCCCAAAGGGTTTAGG + Intronic
1038964747 8:32559133-32559155 ATTCACCCCCCAAATTGTCTTGG + Intronic
1039142245 8:34403097-34403119 AGTCACCCAAATAACTGTTTAGG - Intergenic
1039983555 8:42428921-42428943 AGTCACCCCAGAGAATGTTCTGG - Intronic
1040933838 8:52763373-52763395 AGTCAACTCCAAAAAGTTTTAGG + Intergenic
1044112788 8:88297190-88297212 AGTAACCCCCAAGAATAATTGGG + Intronic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1047323559 8:123813945-123813967 AGTTACCAGCAAAAACGTTTAGG - Exonic
1047521500 8:125598688-125598710 AGCCACCTCCACAAATGTTCTGG + Intergenic
1047911735 8:129537259-129537281 AAAAACCCCCAAAAATGTTGAGG - Intergenic
1050395463 9:5190471-5190493 AGCCACCCCAGAAAATATTTTGG - Intergenic
1051968625 9:22860982-22861004 AGAAACATCCAAAAATGTTTAGG - Intergenic
1057573592 9:96221930-96221952 AGGCATCCTCAAAAATGTTTAGG + Intergenic
1188341778 X:29011371-29011393 ATTCACCTCCATAAATATTTGGG - Intronic
1192236341 X:69298530-69298552 AGTCACCAGCAAAAATGTGATGG - Intergenic
1194544784 X:95219439-95219461 AGACACCCAGAACAATGTTTGGG - Intergenic
1194993957 X:100573208-100573230 AGAGAACTCCAAAAATGTTTAGG - Intergenic
1198731182 X:139730914-139730936 ATTTACCCCCAAAAATATTTGGG - Intronic