ID: 902495261

View in Genome Browser
Species Human (GRCh38)
Location 1:16867918-16867940
Sequence AGTCACCCCCAAAAATGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902495261_902495263 8 Left 902495261 1:16867918-16867940 CCAAAACATTTTTGGGGGTGACT 0: 2
1: 0
2: 0
3: 14
4: 140
Right 902495263 1:16867949-16867971 CTCCAAAAATCTTCCATAAATGG 0: 5
1: 0
2: 2
3: 17
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902495261 Original CRISPR AGTCACCCCCAAAAATGTTT TGG (reversed) Intronic