ID: 902497409

View in Genome Browser
Species Human (GRCh38)
Location 1:16883177-16883199
Sequence TTCATTATACAGCTGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 3, 1: 3, 2: 2, 3: 19, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902497407_902497409 16 Left 902497407 1:16883138-16883160 CCAGGGAGAGTGTCTGGTATTCT 0: 1
1: 0
2: 0
3: 14
4: 138
Right 902497409 1:16883177-16883199 TTCATTATACAGCTGGACAATGG 0: 3
1: 3
2: 2
3: 19
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902497409 Original CRISPR TTCATTATACAGCTGGACAA TGG Intronic
901303787 1:8217799-8217821 TTAATTTTGCAGCTGGAGAAGGG - Intergenic
902164334 1:14557779-14557801 TTCATTCTAGAGCTACACAATGG - Intergenic
902281304 1:15376625-15376647 ATCATTTTACAGCTGGGAAATGG - Intronic
902497409 1:16883177-16883199 TTCATTATACAGCTGGACAATGG + Intronic
903875467 1:26470760-26470782 TACATTTTACAGCTTTACAATGG + Exonic
905681839 1:39878443-39878465 TACATTTTAAAGCAGGACAAAGG + Intronic
908507342 1:64817936-64817958 TTCATTATACAAATGGAGAAGGG + Intronic
909031317 1:70544604-70544626 TTCATTATAGATTTGGATAATGG - Intergenic
910284960 1:85543611-85543633 GTCATGATAAAACTGGACAATGG + Intronic
911036176 1:93550991-93551013 TACATTATAGAGGAGGACAAAGG + Exonic
913198764 1:116478869-116478891 ACCATTACACGGCTGGACAAAGG + Intergenic
913657757 1:120977489-120977511 TTCATTATACAGCTGGACAATGG - Intergenic
914009106 1:143760573-143760595 TTCATTTTACAGCTGGACAATGG - Intergenic
914522324 1:148428765-148428787 TTCATTATACAGCTGGACGATGG - Intergenic
914647736 1:149669225-149669247 TTCATTATACAGCTGGACAATGG - Intergenic
916784695 1:168077963-168077985 TTCAACATCCAGCTTGACAAAGG + Intergenic
917732235 1:177886334-177886356 TTCATCATCCAGCTGGCTAATGG - Intergenic
919045357 1:192444462-192444484 TCCATTGTAAAGCTGGAAAATGG - Intergenic
919508374 1:198429199-198429221 TTCATTTTACAGATGAACCAGGG + Intergenic
922907215 1:229183269-229183291 TTCAGTGTCCAGCTGGAAAAGGG - Intergenic
1065821031 10:29525841-29525863 CTCATTATACACCTGGAATATGG - Intronic
1070033816 10:72702399-72702421 TTCATTTTCCATCTGTACAATGG - Intronic
1070422414 10:76250168-76250190 ATCATTCTTCAGCTGGAGAAGGG + Intronic
1073501962 10:103947825-103947847 TTCAATATACATCTGAAAAATGG - Intergenic
1074268798 10:111931910-111931932 AGCATTATACAGATGGACCATGG + Intergenic
1078139312 11:8680557-8680579 TTCATTATCTAGGTGGACAATGG + Intergenic
1078569640 11:12446209-12446231 TTCATTGGACAGATGGTCAAAGG + Intronic
1078627824 11:12973845-12973867 TTCATCATACAACTTGCCAAGGG - Intergenic
1079817044 11:25074489-25074511 TTCATTATTCAGATGATCAAAGG + Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1084508982 11:69590931-69590953 ATTATTTTACAGCTAGACAATGG + Intergenic
1085612802 11:77968297-77968319 TACATTATTCAGCTGTAAAAAGG + Intronic
1086175983 11:83891538-83891560 TTTATAAAACAGCTGGAAAAGGG + Intronic
1087076718 11:94132659-94132681 TTTATCATACAGGTGGAAAAAGG - Intronic
1087287364 11:96279440-96279462 TTCAGTATACAGATGAACAAAGG + Intronic
1087972136 11:104497513-104497535 TTCAGTACACAGGTGGACAATGG - Intergenic
1089568112 11:119383105-119383127 TTCATTTTACAGATGGATATTGG + Intergenic
1090769630 11:129908533-129908555 ATCATTATCCAGCTGGAGGATGG + Intronic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1093767062 12:22976521-22976543 TTCATTTTACAGATAGCCAAGGG + Intergenic
1095635500 12:44428676-44428698 TGCACTATAAAGCTGGGCAAAGG + Intergenic
1096305054 12:50467275-50467297 TTCATGATGAAGCTGCACAAAGG + Intronic
1097478783 12:60094164-60094186 TAGATTATACAGATTGACAAAGG + Intergenic
1097705436 12:62863742-62863764 TTAATTTTAAAGCTGGAAAAGGG + Intronic
1098184404 12:67880727-67880749 TTCATTTTCCATCTGGAGAATGG + Intergenic
1099091598 12:78317217-78317239 TTCATCCTACAGATGGAAAATGG + Intergenic
1100947400 12:99801484-99801506 GTCATTAGACAACTTGACAAAGG + Intronic
1101851493 12:108406499-108406521 TTCATTATGTAACTGGACATAGG - Intergenic
1102544222 12:113642940-113642962 TTCATAATACAGCTGGAAGTGGG - Intergenic
1102584494 12:113913754-113913776 TTCATTCTACACTTGCACAAGGG - Intronic
1105180762 13:17741885-17741907 TTAATGATACCGCTGGAAAAGGG + Intergenic
1105821991 13:24087992-24088014 TACTAAATACAGCTGGACAAAGG - Intronic
1106411853 13:29516173-29516195 CTCATGATGCAGCTGGACCAGGG - Exonic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1108050287 13:46428434-46428456 TTAAGTATACAGGTGGACAGTGG + Intronic
1108517890 13:51220345-51220367 GACATTAAACAGCTGGACTATGG + Intergenic
1109542810 13:63801750-63801772 TTAAGTATACAGGTGGACAGTGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1112752170 13:102594608-102594630 TTCATTTTACAGCTGTACAAAGG + Intergenic
1113301112 13:109020212-109020234 TTCATAATACAGATGAACATTGG + Intronic
1113977814 13:114243281-114243303 TTCATTACACAGCTTGCTAAGGG - Exonic
1114807975 14:25859623-25859645 TTCATAATGCATCTGAACAATGG - Intergenic
1127700945 15:61500223-61500245 TTCATTAAACTGCAGCACAAAGG - Intergenic
1129204379 15:74027123-74027145 TCCATTATGCAGCTGCAAAAAGG - Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131441574 15:92463640-92463662 TTCATGCTACAGCTACACAACGG + Intronic
1131568956 15:93513272-93513294 GTCATTCTACAGCTCAACAAGGG + Intergenic
1133796029 16:9047182-9047204 ATCATTGTGCAGCTGGAGAAAGG + Intergenic
1134337600 16:13315564-13315586 CTAATTACACAGCTAGACAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1137552881 16:49452694-49452716 TTCGTTCTTCAGCTGAACAATGG + Intergenic
1138293652 16:55868859-55868881 CTCATTTCACAGCTGGAAAATGG - Intronic
1140259451 16:73364919-73364941 CTCATTCTACAGGTGGACCATGG - Intergenic
1141324934 16:83047870-83047892 TTCATTTTACAGGTGAATAAAGG + Intronic
1142414400 16:89933712-89933734 TCCATTTTACAGCTGGGCATTGG + Intronic
1144207807 17:12991387-12991409 TTCATTGTACACCTGTACATTGG - Exonic
1145978639 17:28998554-28998576 TCCATTAAAGAGCTGGAAAAAGG - Intronic
1146436958 17:32859178-32859200 TTCAATATACAGCTAGACAGAGG - Intronic
1147642930 17:42015986-42016008 ATCATTAAAGAGCTGCACAATGG - Intronic
1148085678 17:44992494-44992516 TTCATTATCCAGAGGGACAGAGG + Intergenic
1148575068 17:48704708-48704730 TTCATTTGCCAGATGGACAAAGG + Intergenic
1155490275 18:26394451-26394473 ATCATCATACAGCTGAACACTGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158687759 18:59630058-59630080 TTCCTTATACAGCTGGATCTTGG - Intronic
1160611870 18:80095161-80095183 TTGATTATATAGGTAGACAAAGG - Intronic
1161503626 19:4632017-4632039 TTCACAAGACGGCTGGACAAAGG + Intergenic
1163582408 19:18146493-18146515 TTCATTGAATAGCTGGACACTGG + Intronic
1164738576 19:30560172-30560194 TTCATTTTACAGCTCTGCAAGGG + Intronic
1165296577 19:34931460-34931482 TTTATTCTACAGTTGGAGAAAGG + Intronic
925093182 2:1171791-1171813 GATATTATACAGCTGGACAAAGG + Intronic
925215318 2:2089639-2089661 CTCATTATACAGATGGACGGAGG + Intronic
925616678 2:5750207-5750229 TCCATTCTACAGCTGGGTAAAGG - Intergenic
929889610 2:45908108-45908130 TTGATCATACCGCTGGCCAAGGG + Intronic
930413372 2:51056006-51056028 ATCATTATGCTGCTTGACAAAGG + Intergenic
930853438 2:55986467-55986489 TTCATGGTACAGGTGGAAAAGGG + Intergenic
930963440 2:57289505-57289527 TTCACTATAAAGATGGAAAACGG + Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
937475415 2:122210641-122210663 TTCCTTCTACAGCTGGTCTAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938420226 2:131139827-131139849 ATCATTTTACAGATGGGCAAAGG + Intronic
941472972 2:165912986-165913008 TTCTTTATACAGAAGGATAAAGG - Intronic
947694702 2:232175366-232175388 ATCATTATACACCATGACAAGGG - Intronic
1168784852 20:529409-529431 TGGCATATACAGCTGGACAAAGG - Intronic
1169511912 20:6273976-6273998 TTCATTATGCAGGAGGACACAGG + Intergenic
1169518056 20:6339416-6339438 TGCATTTTCCAGCTGGACAAAGG + Intergenic
1172711348 20:36926837-36926859 TTTATTATACAGTAGTACAATGG + Intronic
1175081595 20:56425137-56425159 ATCATTCTGCAGCTGGCCAAAGG + Intronic
1175574434 20:60050267-60050289 TTCATAATACACCTGGGCAGGGG - Intergenic
1181508239 22:23376148-23376170 TTCATTTCACAGCTGGAAAATGG - Intergenic
1182481380 22:30611196-30611218 TTCATTCTATAGATGGACAAAGG - Intronic
1184963120 22:47945936-47945958 TTCTTTTTACAGTTGGACACAGG + Intergenic
949562394 3:5214669-5214691 TCCATTTTACAGCTGAAGAAAGG + Intronic
951146061 3:19229037-19229059 TTACTCATCCAGCTGGACAATGG + Intronic
951974619 3:28491226-28491248 TTAAATATACAGCTGGATATAGG + Intronic
954527503 3:51284975-51284997 TTCATGATAAAGCTGAACATGGG - Intronic
955730126 3:61976283-61976305 TTTATCAAACAGCTTGACAAAGG + Intronic
956349039 3:68313656-68313678 TGCAGTGTACACCTGGACAATGG + Intronic
956897127 3:73673982-73674004 TTCAGCACACTGCTGGACAAAGG + Intergenic
957122021 3:76105932-76105954 TTCATAATACCACTGTACAATGG + Intronic
958776667 3:98492373-98492395 TTGATTTTACAAGTGGACAAAGG + Intergenic
963188058 3:142440355-142440377 GTCATTATACACCTGAACATAGG + Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
967415593 3:189214631-189214653 TTTTTTATTCAGCTGGACCAGGG - Intronic
974622711 4:64381931-64381953 TTCAGGATAAAGCTGGACAATGG + Intronic
974777008 4:66497464-66497486 TTAATTATACATGTGGGCAAGGG - Intergenic
976276311 4:83282732-83282754 TTCATTTTACAGATGAAAAACGG + Intronic
976784976 4:88809008-88809030 TTTTTTATACAGCTTGACATTGG + Intronic
977065850 4:92313932-92313954 TTCCTTTTACAGCTGGGCATTGG + Intronic
977278968 4:95015326-95015348 TTCAGTATGCAGCAGGACCAAGG - Intronic
978397590 4:108298268-108298290 TTAATTTTACAGCTGGAAAATGG + Intergenic
978509407 4:109500152-109500174 TTTTTTGTACAGCTGTACAATGG + Intronic
980661669 4:135867835-135867857 TTCATTATACAGGTGCAAACAGG - Intergenic
981154483 4:141417648-141417670 TTCATAAGCCTGCTGGACAAGGG + Intergenic
982308577 4:153959977-153959999 TTCCTTATACAGCTGAACCTTGG + Intergenic
983128572 4:163985457-163985479 TTCATTATAAAGCTAGAGATAGG + Intronic
983723245 4:170885205-170885227 TTCATTTGACAGCTGTTCAATGG - Intergenic
983733137 4:171023111-171023133 TTCATTATATAGCTAACCAAGGG - Intergenic
983752192 4:171288632-171288654 TTGATTCTACAGCTTGACAGGGG - Intergenic
985332430 4:188853310-188853332 TTCAATATAAAGCTGGTCAAGGG + Intergenic
986295653 5:6435906-6435928 TTCATTGTTCATCTGCACAATGG + Intergenic
988425226 5:31056055-31056077 TTCATTATTCAGTGGGAAAAAGG + Intergenic
993132973 5:83922631-83922653 ATCATCAGACAGCTGGACGAAGG + Intergenic
993800712 5:92332107-92332129 TTCCTTATGCAGCTGAACACTGG + Intergenic
997119611 5:131160674-131160696 TCCATTGTACAGATGGACAATGG + Intronic
1000071863 5:157747756-157747778 TTCATTTTACTGCTGTACACAGG - Intronic
1002891376 6:1335686-1335708 GTCATTAAACAGCAGAACAAAGG + Intergenic
1004740844 6:18459217-18459239 TTCATTAGACAAATGGAGAAGGG - Intronic
1004741154 6:18462573-18462595 TTCATTAGACAAATGGAGAAAGG - Intronic
1005409504 6:25528351-25528373 TACATTCTACAGCTGGAATAAGG + Intronic
1005900800 6:30214707-30214729 TGAGTTATACTGCTGGACAAAGG - Intergenic
1008368991 6:50712515-50712537 TGCTTTATACAAATGGACAAAGG - Intergenic
1008628497 6:53341687-53341709 ATCATGCTACAGCTGGGCAACGG - Intronic
1009364730 6:62849172-62849194 TTCAATATCCAGCTGGGGAAAGG + Intergenic
1009762126 6:68020814-68020836 TTAATGATACAGCTTGAAAATGG - Intergenic
1010464932 6:76156464-76156486 TTCATTATACTGCTGAAGGATGG - Intergenic
1011189674 6:84716159-84716181 TCCATTATACACCTGAACATAGG - Intronic
1012270416 6:97203340-97203362 ATCAATATACAGCGAGACAAAGG + Intronic
1014037580 6:116785237-116785259 TTCATTTTACAGGTGGGAAAAGG + Intergenic
1014181408 6:118388412-118388434 TTATTTATACAGCTGGACAAAGG + Intergenic
1016540742 6:145160951-145160973 TTCATTTTACAGCAGCAGAAAGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1028309059 7:89306882-89306904 ATCATTACACATCTGAACAATGG - Intronic
1028406862 7:90484895-90484917 TTCTGCATACAGCTGGGCAAGGG + Intronic
1031236180 7:119180960-119180982 TTCATTAGCCAGCTAGTCAAAGG - Intergenic
1031468020 7:122137490-122137512 TTCAGTATAAAGCAGGAAAAGGG - Intronic
1031828262 7:126593838-126593860 TACATTATACATCTGGCTAAAGG + Intronic
1031949610 7:127878605-127878627 TTCATAATACAGATTGAAAACGG - Intronic
1031989124 7:128184812-128184834 TTTATCATTCAGCTAGACAATGG - Intergenic
1033636417 7:143215660-143215682 TTCATTATACAACTTAACACAGG - Intergenic
1034189145 7:149200480-149200502 TGCATTAGAAAGCTGGCCAAAGG - Intronic
1034344959 7:150380178-150380200 TTCATTTTACAGATGAACATGGG - Intronic
1036120799 8:6015027-6015049 TTCATTATAGAGGTGTCCAAAGG - Intergenic
1037052951 8:14399630-14399652 TTCATTATACAGTTGAATAAAGG - Intronic
1039053226 8:33513718-33513740 CACATTACACAGTTGGACAACGG - Intergenic
1040574927 8:48643636-48643658 TTCACTGTCCAGCTGGACACTGG + Intergenic
1043173625 8:76997167-76997189 TTCACTATACATGTGGTCAAAGG + Intronic
1043375815 8:79648217-79648239 CTCATTTTACAGATTGACAAAGG - Intronic
1045328366 8:101134342-101134364 TGCATTGTACAGCTGGCAAAAGG + Intergenic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1047453173 8:124985140-124985162 TTCATTAGACTGATAGACAAAGG + Intergenic
1048127351 8:131650749-131650771 TTTATTATAAAGCTGAACATGGG - Intergenic
1053073959 9:35116885-35116907 TTCATTAGACACCTGTACAAGGG - Intergenic
1055242390 9:74198990-74199012 ATGATTATACAGCTAGAGAATGG - Intergenic
1059394402 9:114025064-114025086 TCAACTATAAAGCTGGACAAAGG - Intronic
1060024039 9:120156026-120156048 CCCATTTTACAGCTGGAAAAAGG + Intergenic
1060994719 9:127869427-127869449 TTGGTTACACAGCTGGACAGAGG - Intronic
1061314386 9:129785533-129785555 TTCATTGTAGAACTGAACAATGG + Intergenic
1062204392 9:135327894-135327916 AACATTATTCAGCTGGAAAAAGG + Intergenic
1186254142 X:7701285-7701307 GTCATTATACACCTGAACATAGG - Intergenic
1186403545 X:9281408-9281430 TACATTCTGCAGCTGCACAAGGG + Intergenic
1187350589 X:18512000-18512022 TTCATTTCACAGCTGTTCAAGGG - Intronic
1188077075 X:25791131-25791153 TTCATTATACAGATTGAAAAAGG + Intergenic
1190914233 X:54798442-54798464 TTCATCTTACAGCTGGATGAGGG - Intergenic
1192294983 X:69837925-69837947 TCCATTTTACAGCTTGACAATGG + Intronic
1194871657 X:99140280-99140302 TTCATTTTACAGATGTAAAATGG - Intergenic
1196469130 X:116005588-116005610 TTCATGATAAAGCAGCACAAAGG + Intergenic
1196916423 X:120540333-120540355 ATCATTAAACAACTGGAAAAAGG + Intronic
1201905684 Y:19083830-19083852 GTCATTATACACCTGAACATAGG + Intergenic