ID: 902499592

View in Genome Browser
Species Human (GRCh38)
Location 1:16900850-16900872
Sequence AAACTAACTCCTGAGAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902499592 Original CRISPR AAACTAACTCCTGAGAAGAT AGG Intronic
900921203 1:5671730-5671752 AACCTAACCCCTGAGAGGTTAGG + Intergenic
901259120 1:7858363-7858385 AAAGTAACTTCTGAAAAGAGAGG + Intergenic
901504445 1:9675708-9675730 CAACTAAGTCCTGGGAAGGTGGG - Intronic
902499592 1:16900850-16900872 AAACTAACTCCTGAGAAGATAGG + Intronic
905692123 1:39951213-39951235 AAAAAAACTTCTGAGAAGACTGG - Intergenic
906289618 1:44611153-44611175 ACTCTAACCCCTGAGAAAATGGG + Intronic
909184420 1:72467606-72467628 AAAGTAAAACATGAGAAGATGGG + Intergenic
910307361 1:85781067-85781089 AAAATGATTCCTGAGAAGTTAGG - Intronic
912408070 1:109458654-109458676 AAACTAGCTCCTGTTAAGATAGG + Intergenic
912467356 1:109883227-109883249 AACCTAACTCCTGAGATGTTAGG + Intergenic
915923148 1:159993242-159993264 AAACTAACTCGAGAGAATGTAGG + Intergenic
923017205 1:230136150-230136172 CCTCCAACTCCTGAGAAGATGGG - Intronic
923730500 1:236545316-236545338 AGACTAACTCCTTAGGAGAAAGG - Intronic
1064991878 10:21263555-21263577 AAACTAACCCCCGGGGAGATAGG - Intergenic
1065007163 10:21390635-21390657 CAACTTACTTCTTAGAAGATGGG + Intergenic
1071744166 10:88396631-88396653 AATGTAATTCCTGATAAGATAGG - Intronic
1073545326 10:104343336-104343358 AAATTAAGTCCAGAGAAGTTAGG + Intergenic
1073691642 10:105815868-105815890 AAACAAACTAATGAGAAGAGAGG - Intergenic
1075608841 10:123835685-123835707 ACCCTCTCTCCTGAGAAGATGGG + Intronic
1078614633 11:12853815-12853837 ATACAAACTCCTGAGAAGGTGGG + Intronic
1085550916 11:77370542-77370564 AAAGTAGCTCCAGAGAAAATGGG - Intronic
1089966876 11:122660529-122660551 AGCCTAACACCGGAGAAGATGGG + Intronic
1091120162 11:133050648-133050670 AAACTAAATCCTAAGAAGGGAGG - Intronic
1091857575 12:3752072-3752094 AACCTAACTCATGAGGTGATGGG - Intronic
1093320745 12:17710655-17710677 AAACTATGTCATGATAAGATGGG - Intergenic
1095762775 12:45858653-45858675 AAACTAACTTATGAGATGATGGG - Intronic
1096893751 12:54798838-54798860 AAATTAAATCCTGGGGAGATTGG - Intergenic
1100024631 12:90112836-90112858 AAACAAACTCCTTAACAGATGGG + Intergenic
1100879401 12:98999697-98999719 AAACTAACTGTTCAGCAGATGGG + Intronic
1101860676 12:108479989-108480011 AAACTGAGCCTTGAGAAGATGGG - Intergenic
1104195379 12:126532207-126532229 AAGCTAACCCCTGAGGTGATGGG - Intergenic
1106371936 13:29142981-29143003 AAACAAAAACCAGAGAAGATTGG + Intronic
1109075654 13:57831983-57832005 GAATTAACTTCTGAGAGGATAGG + Intergenic
1112198048 13:97245062-97245084 AATAAAACTCCTGAGAAGTTTGG + Intronic
1113430265 13:110244337-110244359 AAAAAAACTCCAGAGATGATAGG + Intronic
1114946880 14:27693436-27693458 AAACTCACACCTGCCAAGATTGG + Intergenic
1117568728 14:57024042-57024064 GAACTAATTCATGAGTAGATGGG - Intergenic
1117738346 14:58790382-58790404 AAACTAGCTCCAGAGAGGAAAGG + Intergenic
1118157732 14:63257568-63257590 AAAGCACCTCCTGAGAAGAAGGG - Intronic
1118167503 14:63351942-63351964 AAACTACCACCTGAGAAAAGTGG - Intergenic
1118482701 14:66182871-66182893 AAACTAAGTCCTAACATGATGGG + Intergenic
1120441712 14:84549373-84549395 ATACTATCTCCTTTGAAGATTGG + Intergenic
1120648878 14:87106820-87106842 AAAGGAACTCCTGAGAAGCAGGG - Intergenic
1121675634 14:95750454-95750476 AAATAAAGTCTTGAGAAGATGGG + Intergenic
1121895859 14:97646972-97646994 TAGCTCACTCCTGAGAAGAAAGG + Intergenic
1122351055 14:101091105-101091127 AGACTGACTCCTGATAAGAGAGG + Intergenic
1123132006 14:105994886-105994908 AAACTGAAATCTGAGAAGATAGG + Intergenic
1123180114 14:106461318-106461340 ATATAAACTCCTGAGAAGAAAGG + Intergenic
1124341716 15:28894262-28894284 AAAATACCTACTGAGTAGATGGG - Intronic
1124424532 15:29552866-29552888 ACAGTAACTCCTGAAAAGAACGG + Intronic
1125242643 15:37593877-37593899 AAAAAAACTGATGAGAAGATGGG + Intergenic
1127651655 15:61014517-61014539 ATTCTAACTCCTTAGAAGACAGG - Intronic
1128073081 15:64809337-64809359 AACCTAACTTCTGAGAGGTTAGG - Intergenic
1130565266 15:84988670-84988692 TGACTAACTCCTGAGAAGATAGG - Intronic
1130754818 15:86752098-86752120 ACATTAACTCCTGCTAAGATGGG - Intronic
1131743253 15:95417228-95417250 GAACTAACTCCTGAAAGGCTGGG + Intergenic
1132267866 15:100492692-100492714 AAAGTAATTCCTGATAAAATAGG + Intronic
1133561119 16:6951269-6951291 AAACTGACCCCTCAGAAGATGGG - Intronic
1138328972 16:56197507-56197529 CAGCTGACTCCTGAGGAGATCGG - Intronic
1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG + Intronic
1143790024 17:9287365-9287387 AACATCTCTCCTGAGAAGATAGG - Intronic
1144089522 17:11841933-11841955 AAACTACCTTGTGAGAAAATGGG - Intronic
1150662295 17:67093513-67093535 AAACTATTTCCTGTGACGATGGG + Intronic
1152863222 17:82708289-82708311 AAACTAACAGCTGAGCAGTTTGG + Intergenic
1155086701 18:22466007-22466029 AAACTACCCCCAGAGAAGCTGGG - Intergenic
1155129821 18:22922322-22922344 ACACTATCTCCTTAGAAGTTAGG + Intronic
1156277424 18:35596960-35596982 AAATTAACTCCTGCTAAGTTAGG - Intronic
1158970995 18:62666321-62666343 TAACTAACACCTTAGCAGATAGG - Intergenic
1162605499 19:11704230-11704252 AAAGTAATTCCTGATAAGAAAGG - Intergenic
1166162172 19:40962351-40962373 GAACTCAGTCATGAGAAGATGGG + Intergenic
925396756 2:3539025-3539047 AAACTAACAACTCAGAAGAATGG - Intronic
925658884 2:6181474-6181496 AAATTAACTCTTGGGAAGAGAGG - Intergenic
925841869 2:7999647-7999669 AAACTAGCTCCTGAAAAGAGAGG + Intergenic
926618791 2:15027601-15027623 AAAATAACTGCTGAAAACATTGG - Intergenic
927779144 2:25925494-25925516 AAAATAGGTCCTGAGAAGAGAGG + Intergenic
927991239 2:27448831-27448853 AAGATAGTTCCTGAGAAGATAGG + Intronic
928840663 2:35600485-35600507 AAACCAACACCTGAAAAGAAAGG - Intergenic
929481904 2:42316664-42316686 AGACTAACTCCAGGGAAGAGTGG - Intronic
930636079 2:53807119-53807141 AAACTAAATGCTGAGAGGTTTGG - Intronic
930716733 2:54600334-54600356 AAACTCACTACAGAGAAGACAGG - Intronic
933518833 2:83344737-83344759 AAACATACTCCTGGGAAAATTGG - Intergenic
934500881 2:94858934-94858956 AAAATAACTCAAGAGAAAATAGG - Intergenic
935402252 2:102672451-102672473 AAAATAAGTCATGAAAAGATGGG + Intronic
935408286 2:102732813-102732835 AAAATAATACCTGAGAAGAAAGG + Intronic
936674067 2:114693866-114693888 AAAATACCTCCTGAGAAAAATGG - Intronic
936719022 2:115227132-115227154 AAATCAAATCTTGAGAAGATTGG - Intronic
936884705 2:117296493-117296515 AAACCAAATCCAGAGAACATTGG + Intergenic
941535388 2:166716532-166716554 AAAATAATTACTGATAAGATAGG + Intergenic
943096552 2:183436118-183436140 AAACAAACTCCTCTGAAAATGGG - Intergenic
943571069 2:189576044-189576066 ACACAAACTCCGGAGAATATAGG + Intronic
944184472 2:196931640-196931662 AAACTAACTCCAGTTAAAATGGG + Intergenic
947995153 2:234521307-234521329 TAACTCCCTCTTGAGAAGATCGG + Intergenic
1169662245 20:7992626-7992648 AAACCAACTCCTGAGTTGATAGG + Intronic
1171023000 20:21603542-21603564 AAACTAAATGCTTAGAAGAGGGG - Intergenic
1173105662 20:40131395-40131417 AAGCTCACTCCTGAGATGACAGG + Intergenic
1177016951 21:15802863-15802885 AAACTGCTTCTTGAGAAGATTGG + Intronic
1177904787 21:26962302-26962324 AAGCTAAATCCTGGGGAGATTGG + Intronic
1178811839 21:35891020-35891042 AAACTAAATCCTCATTAGATTGG - Intronic
1180318974 22:11303590-11303612 AACCTAACCCCTGATAAGTTAGG - Intergenic
1184073804 22:42163419-42163441 AAAGTAACTCTTGAAAAGTTAGG - Intronic
950578642 3:13848390-13848412 AAACTACCTACTTAGAAAATAGG + Intronic
951805757 3:26642042-26642064 AAAATATTTCCTGAGAAGAGTGG + Intronic
952014013 3:28935405-28935427 TAACTGACTGCAGAGAAGATGGG - Intergenic
953966880 3:47314910-47314932 AAACCAGCTACAGAGAAGATAGG - Intronic
955683491 3:61527000-61527022 AGACTAACACATGAAAAGATAGG + Intergenic
956938755 3:74133125-74133147 AAACTACCACCTGAAAACATTGG + Intergenic
960532445 3:118780195-118780217 CAATTAACTCCAGAGTAGATAGG - Intergenic
960597707 3:119421721-119421743 AAAGTGACTCCAGAGAACATGGG - Intergenic
962112483 3:132467933-132467955 AAACAAAGTCCAGAGAAGAAGGG - Intronic
962496402 3:135944783-135944805 GGACTAACTCCAGAGAAGAAGGG + Intergenic
964515091 3:157499233-157499255 AAACTAAATAATGAGAAGGTGGG - Intronic
967592466 3:191294639-191294661 ATAAAAGCTCCTGAGAAGATTGG - Intronic
967620016 3:191621431-191621453 AAAGTAACAACTGAGAAGCTGGG + Intergenic
969066233 4:4483846-4483868 AAAAAAATTCCTGAGAGGATTGG - Intronic
973843343 4:54885537-54885559 AAGCTACCTTCTGAGAAGAGCGG - Intergenic
974138454 4:57850620-57850642 GAATTAATTCCTGAGAATATGGG + Intergenic
974579095 4:63771664-63771686 AAACTATCACCTGAGTAGTTTGG - Intergenic
975588345 4:75974417-75974439 AAAACAACAACTGAGAAGATCGG + Intronic
977265756 4:94851475-94851497 AAACTAACTTCTTGGAAGTTAGG - Intronic
979320278 4:119315321-119315343 AAAGTATATCCTGAGTAGATGGG - Intergenic
982316601 4:154037957-154037979 AGAAAGACTCCTGAGAAGATGGG - Intergenic
982635774 4:157895121-157895143 AAAGTAGAGCCTGAGAAGATGGG + Intergenic
986836950 5:11649621-11649643 AAACAAACTCTTGATGAGATTGG + Intronic
988098545 5:26648902-26648924 AAACTAACCCCTGAGAACTAAGG + Intergenic
988408702 5:30857790-30857812 AAAATAAGTCCTTAGAACATGGG - Intergenic
988763720 5:34346511-34346533 AAACAATCTACTGAGAGGATAGG - Intergenic
991641883 5:68762383-68762405 AATATAACTACTGAGATGATGGG - Intergenic
992629781 5:78669025-78669047 TAAGTAACTCTTGAGAAAATAGG + Intronic
993480579 5:88419373-88419395 ACACTCACTTCTGAGTAGATGGG - Intergenic
993706247 5:91174434-91174456 AATCTAAATCCTGTGAAGAATGG - Intergenic
996742628 5:126814945-126814967 GAGCTAACTCCTTAGCAGATAGG + Intronic
998270172 5:140699464-140699486 AAACTACCTCTTGAGGAGACAGG - Intronic
998810163 5:145958365-145958387 GAACCAACTCCTAAGAATATTGG - Intronic
999120073 5:149202490-149202512 AAAGTAGCTCCTGACTAGATGGG + Intronic
1003319135 6:5036886-5036908 AAACTGATGCCTGAGAAGTTAGG + Intergenic
1004381315 6:15135084-15135106 AACCTAACTCATGGTAAGATTGG - Intergenic
1007202920 6:40125772-40125794 AAACTTACGCCTGAGAAAATAGG - Intergenic
1007516956 6:42420163-42420185 AAACTAAGTCCTGGGAAGGGAGG - Intronic
1008500045 6:52171451-52171473 AAACTATCTCCTGAGACTGTGGG - Intergenic
1011654107 6:89534057-89534079 AAACTAATTCCCCAGATGATGGG + Intronic
1012557615 6:100535059-100535081 AAACTAACACCTTAGAAGAGTGG - Intronic
1012834923 6:104252717-104252739 TAACTCACTCCTGAGATAATGGG - Intergenic
1014492873 6:122083249-122083271 AAACTGACATCAGAGAAGATGGG + Intergenic
1014683633 6:124466569-124466591 AGACTCTCTCCTGAGAAGAAGGG - Intronic
1015581628 6:134731173-134731195 AAACTGACTTATGAGAAAATAGG + Intergenic
1015929354 6:138341824-138341846 AAAATATCTCCTGAGATCATTGG + Exonic
1017611960 6:156196360-156196382 AAATTAACTAATGAAAAGATTGG - Intergenic
1017704665 6:157111102-157111124 TAACTAGCTCCTGAGAATAAGGG - Intronic
1018394724 6:163369604-163369626 AAAATAAGCCCTGAGAAGAGGGG + Intergenic
1019829926 7:3317652-3317674 AAACCAGCTCCTGTGAACATGGG - Intronic
1020853529 7:13388321-13388343 GGAATAACTCCTGAGAATATAGG + Intergenic
1022467317 7:30660636-30660658 AAACCAGCACCTGTGAAGATGGG + Exonic
1023243382 7:38174609-38174631 AAACTAACTCAAGAAAAAATAGG - Intergenic
1024118548 7:46214931-46214953 AAAACAACTTCTGAGAATATTGG - Intergenic
1024810763 7:53209040-53209062 TAACTAAATTCTGAGAAGAGTGG + Intergenic
1026286267 7:68965789-68965811 AAACTGAATCCTCAAAAGATTGG - Intergenic
1027967964 7:85038334-85038356 AAACTAGCTCCTGAGAATGGAGG + Intronic
1030850703 7:114482549-114482571 AAACAAACTACTGAGAATGTTGG - Intronic
1033871180 7:145754875-145754897 AAAGTAACGCCTTAGCAGATAGG - Intergenic
1037103257 8:15074010-15074032 AAACTAACTCACAAGAAAATAGG + Intronic
1038865517 8:31435040-31435062 AAGCCAACTCCTCAGAAGTTGGG - Intergenic
1039157838 8:34581869-34581891 AATGTAACTGATGAGAAGATAGG + Intergenic
1041064107 8:54064566-54064588 AGAATAACAGCTGAGAAGATTGG - Intronic
1041237718 8:55821525-55821547 AAACCAATTTCTGAGAAGGTAGG - Intronic
1041376981 8:57215390-57215412 GAAGAAACACCTGAGAAGATGGG + Intergenic
1041975025 8:63788708-63788730 AAAATAACTCCTGGGAATTTTGG - Intergenic
1042752539 8:72174041-72174063 AAACAAACTCATAAGAGGATGGG - Intergenic
1042765016 8:72311948-72311970 AAACAAACTCATAAGAGGATGGG - Intergenic
1043402531 8:79898116-79898138 AAAATAACTTCTGAGAAAAAAGG - Intergenic
1044376593 8:91480752-91480774 AAACTAGGTCCTGAACAGATGGG - Intergenic
1045237282 8:100364366-100364388 AAACTAACTCCTAAGAGGCAAGG - Intronic
1045726886 8:105184763-105184785 AAAAGAATTCCTGAGAAAATTGG - Intronic
1047000307 8:120566588-120566610 CCACAAACCCCTGAGAAGATGGG + Intronic
1048222832 8:132558721-132558743 AAACTATCTCATGACAAAATTGG - Intergenic
1048303212 8:133266424-133266446 AAACTCACGCTTGAGAAGAAGGG + Intronic
1050535048 9:6623778-6623800 AAACCCACATCTGAGAAGATAGG + Intronic
1052307913 9:27031821-27031843 AAATAAACTCCTGAGTAGCTAGG + Intronic
1052704377 9:31977089-31977111 AAAATAACTCCTTTGTAGATGGG + Intergenic
1053906647 9:42850825-42850847 AAAATAACTCAAGAGAAAATAGG + Intergenic
1054368409 9:64367829-64367851 AAAATAACTCAAGAGAAAATAGG + Intergenic
1054528314 9:66154678-66154700 AAAATAACTCAAGAGAAAATAGG - Intergenic
1054676030 9:67857581-67857603 AAAATAACTCAAGAGAAAATAGG + Intergenic
1055864223 9:80793522-80793544 AATCTAAATCCTGAGAAGAGGGG + Intergenic
1058949911 9:109893741-109893763 AAAATAACTGCTGAGATGGTTGG - Intronic
1059491582 9:114672091-114672113 AAAGTAGCTCCTGTGAAGCTAGG + Intergenic
1060563570 9:124568763-124568785 AAACTACCTCCTGTGAAGGTGGG + Intronic
1186727851 X:12376023-12376045 ATCCTACCTCCTGAGCAGATGGG - Intronic
1188452092 X:30318013-30318035 TAACAAGCTCCTGAGAAGGTTGG - Intergenic
1188686103 X:33072514-33072536 AAAGTAATTCCTGAGAAATTTGG + Intronic
1190415311 X:50174895-50174917 AATCTAACTCCAGAGAACACAGG + Intergenic
1194227463 X:91279095-91279117 AAGATAACTTCTGAGAACATGGG - Intergenic
1194319685 X:92429229-92429251 AAATAAACTCCTGAGAACATAGG + Intronic
1197859791 X:130958250-130958272 TAACTAACTCCAAAGAAGAGAGG + Intergenic
1198689980 X:139270498-139270520 AAAATAACTCCTTTGAAGACTGG + Intergenic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic
1201071492 Y:10150892-10150914 AACCTAACTCCTGATAGGTTAGG + Intergenic