ID: 902499774

View in Genome Browser
Species Human (GRCh38)
Location 1:16902390-16902412
Sequence ATCTGATTCTAGAAGAGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 4, 2: 1, 3: 16, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902499774 Original CRISPR ATCTGATTCTAGAAGAGTAA GGG Intronic
901894069 1:12293773-12293795 AGATGAATCTGGAAGAGTAAAGG + Intronic
902452709 1:16507825-16507847 ATCTGATTCTACAAGAGTAAGGG - Intergenic
902472769 1:16660489-16660511 ATCTGATTCTACAAGAGTAAGGG - Intergenic
902486035 1:16746954-16746976 ATCTGATTCTACAAGAGTAAGGG + Intronic
902499774 1:16902390-16902412 ATCTGATTCTAGAAGAGTAAGGG + Intronic
902552262 1:17226121-17226143 TTCTGATTCCAAAAGAGTGAGGG + Exonic
903680459 1:25093028-25093050 ATCTGCTTCTGCAAGAGTCAAGG - Intergenic
905339544 1:37268866-37268888 AGCTGGTTCTAGAAGGGCAAGGG + Intergenic
905479184 1:38249546-38249568 ATCTTATGCTAGAAGAGAAATGG + Intergenic
906090470 1:43174926-43174948 ATCTGATTTGTAAAGAGTAATGG - Intronic
906951753 1:50340708-50340730 CTGTGATTCTAGAAGAGGGATGG - Intergenic
909155132 1:72064681-72064703 TTCTCATTCTAGATGATTAATGG - Intronic
910217863 1:84860586-84860608 ATCTTATTTCAGAAGAGGAAAGG - Intronic
910584850 1:88868285-88868307 CTCTGTTTCTAGAACACTAAAGG - Intronic
910851505 1:91653815-91653837 ATCTGGTGTTGGAAGAGTAAGGG + Intergenic
911058913 1:93731207-93731229 ATGGGATTCTGGAACAGTAAAGG + Intronic
914926101 1:151889442-151889464 ATGTGATTCTAGCAGGGTACAGG - Intronic
915192965 1:154167554-154167576 ATCTGATTCTACCAGAGTGATGG - Exonic
916680425 1:167099499-167099521 ATCTGAACATAGAAGAATAAAGG + Intronic
917376434 1:174352912-174352934 ATCTCTTTGGAGAAGAGTAAAGG - Intronic
917532238 1:175845807-175845829 TTCTGTTTCTAGAAAAGTACCGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919458246 1:197845791-197845813 GTGTCATTCTAGAACAGTAAGGG - Intergenic
922614564 1:226954220-226954242 TTCTGTTTCTTGAAGAATAATGG + Intronic
922850257 1:228727172-228727194 ATTTGATTTTAGAAGAGCAGAGG - Intergenic
923354538 1:233140999-233141021 ATGTGATTCCAGAGGTGTAATGG - Intronic
924281409 1:242440850-242440872 ACCTGATTTTAGAAGTGTGAAGG - Intronic
1063141093 10:3257258-3257280 ATCAGAATCCAGAAGAGAAAAGG + Intergenic
1069235257 10:66063499-66063521 ATCTCTCTCTAAAAGAGTAAAGG - Intronic
1071746029 10:88420499-88420521 ATCTGAAACTAGAAGAGCTATGG - Intronic
1072008268 10:91278077-91278099 GACTGATTCTAGAAAAATAATGG + Intronic
1076272915 10:129170572-129170594 ATCTGATGCTGGGAGAGTATTGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1081275161 11:41139608-41139630 CCCTGATTCTAGAAGTTTAATGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1084764799 11:71301369-71301391 ACCAGATTCTAGAAGAGACAAGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087360873 11:97157957-97157979 ATCTGATTATAGCAGAATTAAGG - Intergenic
1087535876 11:99444542-99444564 ATCTGCTTATACAAGAATAAAGG - Intronic
1088536245 11:110865339-110865361 ATCTCCTTCTAAAAGAATAAGGG - Intergenic
1088577426 11:111285454-111285476 ATCTAATTCTAGAGTAGGAAGGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1093101313 12:15032961-15032983 GTCTTAATCTAAAAGAGTAATGG - Intergenic
1094008176 12:25778241-25778263 ATCTGCTACTAGAAGATGAAAGG - Intergenic
1094355814 12:29576067-29576089 ATCTGATTCAAAATGAGCAAAGG - Intronic
1096442929 12:51661184-51661206 ATTTGATTTTAGATGAGGAAAGG - Intronic
1096756873 12:53806944-53806966 ATCTTATGATAGAAGAGTGAAGG + Intergenic
1097009552 12:55942446-55942468 ATCTGAACCTAGAAGGGTCAAGG + Intronic
1097055248 12:56245264-56245286 ATCTGAATCTGGAAGTGGAATGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1099829823 12:87827135-87827157 ATCTGATTCTGGCTGAGAAATGG + Intergenic
1100294847 12:93251205-93251227 GTCTTAACCTAGAAGAGTAATGG - Intergenic
1101071900 12:101084473-101084495 ATGTCATTTTAGAACAGTAAAGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1104283074 12:127396251-127396273 ATTTCATTCTAGTAGAGGAATGG - Intergenic
1109261978 13:60156139-60156161 ATCTGAAGCTGGAAGAGTCAAGG - Intronic
1109734996 13:66471781-66471803 CTCTGATACTAGCAGAGCAATGG - Intronic
1110924060 13:81128389-81128411 ATCTGATTATATAAGTGGAAAGG - Intergenic
1112121715 13:96419702-96419724 ACCAGAAGCTAGAAGAGTAAAGG - Intronic
1112159843 13:96855709-96855731 CTCTGATTCTATAAGCATAATGG + Intergenic
1112391620 13:98990154-98990176 ATCTGTTTAGAGAAGAGTAAAGG + Intronic
1114583442 14:23786616-23786638 ATATGAGTCAAGAAGAGCAATGG + Intergenic
1115234744 14:31197936-31197958 AAGTGATTCAAGAAGAGAAAGGG - Intronic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116897655 14:50332879-50332901 AGCTGATTTTAGAAGGGTGAAGG - Exonic
1117476220 14:56097742-56097764 CTCCAATTCTAGAAAAGTAATGG + Intergenic
1120203392 14:81562590-81562612 ATTTGATTTTTGAAGACTAAGGG + Intergenic
1122566251 14:102658741-102658763 ATTGGATTCTAGAACAGAAATGG - Intronic
1125119078 15:36131668-36131690 ATCTGATTATAGAAGGTGAAAGG - Intergenic
1125260182 15:37814637-37814659 ATCTATTTCTAGAACAGAAAGGG + Intergenic
1126453153 15:48832536-48832558 ATCAGATTCAAGAAGACCAATGG - Intronic
1126545812 15:49872802-49872824 ATTGGATCCTAGAAGAGAAAAGG + Intronic
1127240005 15:57102857-57102879 TTCTGATTATAGAAAACTAAGGG - Intronic
1127540611 15:59934989-59935011 ATCTTTTTGTAGAAAAGTAAGGG - Intergenic
1128652489 15:69428731-69428753 ATCTGATTATAGAAGAATTTAGG + Intronic
1130173792 15:81546555-81546577 ATCTGAGTCAAGAACAATAAGGG - Intergenic
1131237359 15:90708481-90708503 AGCTGATTTTGGAAGAGTTACGG + Intergenic
1131971919 15:97902118-97902140 AGATGATTCTAGAAAAGGAAAGG - Intergenic
1135493578 16:22931678-22931700 ATCTGATTTTATTAGAGTCAAGG - Intergenic
1142029646 16:87832134-87832156 CTCTGTTTCTAGAAGACTGAAGG + Exonic
1143313452 17:6013109-6013131 CTCTGATTCTGGAAGGGTAGAGG - Intronic
1143950368 17:10627809-10627831 GTCTGATTCCAGAAGATTAGGGG - Intergenic
1146498381 17:33343284-33343306 CTCTGAGTGTAGAAGAATAAAGG - Intronic
1149673309 17:58434879-58434901 ATGTGATTATTGAAGAGTAAGGG + Intronic
1150988336 17:70225682-70225704 ATATGATTCTAGAACATGAATGG - Intergenic
1151271942 17:73003590-73003612 ATCTGAGTCTACATGAGAAAAGG + Intronic
1151796875 17:76352731-76352753 ATCTGGTTCTAGCAGAGTAGGGG - Intronic
1153617323 18:6947025-6947047 ATCTGTTTTTAAAATAGTAATGG + Intronic
1153703461 18:7720264-7720286 ACCTGACAGTAGAAGAGTAATGG + Intronic
1153736939 18:8080980-8081002 ATCTGATTTTAGGGGAGGAAAGG - Intronic
1156330445 18:36116772-36116794 TTCTGATTCTAAAATAGTGAGGG + Exonic
1157302561 18:46489583-46489605 AACTGATTCTGGAAGGATAATGG - Intronic
1157316685 18:46596000-46596022 TTCTGGTTCTAGAAGGTTAAAGG + Intronic
1157801403 18:50624376-50624398 TTTTGGTTCCAGAAGAGTAAAGG + Intronic
1158989353 18:62852855-62852877 AACTGAACCAAGAAGAGTAATGG + Intronic
1159491903 18:69147591-69147613 GTGAGATTCAAGAAGAGTAAAGG - Intergenic
1165447518 19:35864676-35864698 ATCTGGTTCTGGAGGAGGAAGGG + Exonic
1202705161 1_KI270713v1_random:17309-17331 ATCTGATTCTACAAGAGTAAGGG - Intergenic
925371305 2:3347624-3347646 AACTGATTCTTCAAGAGTGAGGG + Intronic
928967646 2:36993113-36993135 GGCTGATTCTAGAACAGTGAGGG + Intronic
929731811 2:44502769-44502791 AGCTGATTTTAGAAGAGAGAAGG + Intronic
930325763 2:49915161-49915183 ATGTGATACTAGAAGAATGAAGG + Intergenic
931859763 2:66342500-66342522 ATGTGATTCTAGGAGAGCAATGG - Intergenic
933666492 2:84969503-84969525 ATCTCTTTCTACAAGAGAAATGG + Intergenic
934723498 2:96598961-96598983 ATGTGATTCTAAAAGAATAATGG + Intronic
935319131 2:101868550-101868572 ATCTCAGTGTGGAAGAGTAAAGG + Intronic
937261317 2:120588237-120588259 GTCTGAGTCTAGAAGAGTGCAGG - Intergenic
938275259 2:130014968-130014990 AACTCATTCTGCAAGAGTAAAGG - Intergenic
938440104 2:131322310-131322332 AACTCATTCTGCAAGAGTAAAGG + Intronic
939918641 2:148080874-148080896 ATCAGAATCTAGAAGAAAAAAGG - Intronic
940063855 2:149604343-149604365 ATATGATTATAGAAAACTAAAGG - Intergenic
940517848 2:154703416-154703438 ATGTGATGTTAGAAGAGGAAAGG - Intronic
940941521 2:159566824-159566846 ATCTTATTTTAGAACAGTAAAGG - Intronic
946553139 2:220824135-220824157 ATCTGCTTGGAGAAGAGTACAGG - Intergenic
947425636 2:229980676-229980698 TTCTGATACTGGAAGAGAAAAGG + Intronic
948230154 2:236343289-236343311 ATCTGAGTCTGGGAGAGCAAGGG - Intronic
1169773388 20:9225753-9225775 ATCTGCTTCTATAAGAGAGAGGG + Intronic
1169797379 20:9478196-9478218 AGCTAATTCGAGAAGAGGAAAGG - Intronic
1171205098 20:23272923-23272945 CTGTGAATCTAGAAGAGTTATGG - Intergenic
1173237312 20:41258415-41258437 ATAGGATTCTGGAACAGTAAAGG - Intronic
1176935633 21:14863398-14863420 GTCTTATTCTAGAAAATTAAGGG + Intergenic
1177424298 21:20902452-20902474 GTATTATTCTTGAAGAGTAAGGG - Intergenic
1177693893 21:24546642-24546664 ATACAATTCTAGAAGAGCAAAGG + Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1185029626 22:48434855-48434877 TTCTGATTCTTGAAGCTTAAAGG + Intergenic
949688882 3:6611504-6611526 ATCAGATTCTTGAAGAGTCCTGG + Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951987240 3:28634295-28634317 ATCTAATTCTATAATAGCAAGGG - Intergenic
953157633 3:40389015-40389037 ATATGATTTTAGGATAGTAAGGG + Intronic
955002318 3:54938821-54938843 ATATGATTCTAGAAAAGTCAGGG + Intronic
955185976 3:56715543-56715565 ATCTGATTTTAAAATAGTAATGG - Intergenic
956677491 3:71749741-71749763 ATTTGATTATACAAGAATAATGG + Intronic
957055295 3:75437884-75437906 ATCTGAATCTGGAAGGATAAAGG + Intergenic
957684224 3:83479765-83479787 ATGGGATTCTGGAAGAGAAAAGG - Intergenic
957900047 3:86477645-86477667 ATCTGATTTTAAATGGGTAAAGG - Intergenic
958270530 3:91493536-91493558 TTCTGATTATAGATGAGTAGAGG - Intergenic
958417170 3:93888500-93888522 ATTTCATTATAGAATAGTAAAGG + Intronic
962943465 3:140146659-140146681 ATCTTAGTCCAAAAGAGTAATGG + Intronic
962968617 3:140378342-140378364 ATCTGGCTCTAATAGAGTAAGGG + Intronic
963076853 3:141355251-141355273 ATCTGATTTTAGAGAAGTACAGG - Intronic
964451648 3:156818257-156818279 ACTACATTCTAGAAGAGTAAAGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966935213 3:184703226-184703248 GTCTTAACCTAGAAGAGTAACGG - Intergenic
966979800 3:185121621-185121643 ATCTGATGGGAGAAGAGTAGAGG + Intronic
968188813 3:196652763-196652785 AACTGAATCTAGACGTGTAAGGG - Intronic
972678748 4:41285499-41285521 ATTTTATTTTAGGAGAGTAAAGG - Intergenic
973897271 4:55426558-55426580 ATATGATTCTAGAATATAAAAGG - Intronic
975539204 4:75487364-75487386 AACTGAGTTTCGAAGAGTAAAGG + Intronic
975880676 4:78902620-78902642 ATCAGATTATAGAAGATAAATGG - Intronic
976111190 4:81675625-81675647 TTTTAATTCTAGAAGAGTTAGGG + Intronic
976519812 4:86013850-86013872 ATCAGATTCTTGAAGATGAAAGG + Intergenic
976564125 4:86533954-86533976 TCATGATTCTAGGAGAGTAATGG - Intronic
977113029 4:92984699-92984721 GTCAGATTCTAGAACAGAAAAGG - Intronic
978054131 4:104241956-104241978 TTATTGTTCTAGAAGAGTAAGGG + Intergenic
979001374 4:115225048-115225070 ATCTGAATCTATAAAAATAAAGG + Intergenic
979943084 4:126787626-126787648 ATTGGAGTCTATAAGAGTAAAGG + Intergenic
981384430 4:144112002-144112024 CTCTGCTTCTGGAAGAGCAAGGG - Intronic
981518847 4:145639450-145639472 AGTTGATTCTACAAGAGTTATGG - Exonic
982210976 4:153036122-153036144 ATTTGAGTCAACAAGAGTAAAGG + Intergenic
982764189 4:159324592-159324614 AATTGATTTTAGAAGAGTCATGG + Intronic
984238450 4:177189706-177189728 ATATGAAAGTAGAAGAGTAATGG + Intergenic
986384735 5:7221201-7221223 ATCAGATTCTGGAACAGAAAAGG - Intergenic
987627186 5:20417692-20417714 ATGTGATTTTGGAAGAGTAAAGG - Intronic
987849483 5:23332013-23332035 ACCCAAGTCTAGAAGAGTAAAGG + Intergenic
987854984 5:23409483-23409505 ATGGAATTCTAGAAGAGAAAAGG + Intergenic
988054071 5:26069883-26069905 CTATTATTCTAGAAGAATAATGG - Intergenic
988566600 5:32324043-32324065 AACTGATTCTGGAAGTGAAATGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989430580 5:41350408-41350430 ATCTGAAGCTCTAAGAGTAAGGG + Intronic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991417906 5:66410570-66410592 TTCTGATTCTAGAAGGCAAATGG - Intergenic
996116564 5:119626852-119626874 TTCTGATCCTTGAAGAGTCAGGG - Intronic
996479638 5:123960347-123960369 TTCTGTTTTCAGAAGAGTAAGGG - Intergenic
996496513 5:124163006-124163028 AGCTGATTATAGAAGATGAAAGG + Intergenic
999078401 5:148819269-148819291 ATCTGATGCTAGAATACTAACGG + Intergenic
1002805261 6:567495-567517 TTCTGTCTCTAGAAGAGGAAAGG + Intronic
1003469376 6:6414950-6414972 ATCTGAGTCTAGAAGGGAAAAGG + Intergenic
1004772514 6:18800183-18800205 ATCTAATTCTAGATGAATTAGGG - Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1006899076 6:37488545-37488567 AGAAGATTCTAGAAGTGTAAGGG + Intronic
1008984615 6:57527807-57527829 TTCTGATTATAGATGAGTAGAGG + Intronic
1009172662 6:60420695-60420717 TTCTGATTATAGATGAGTAGAGG + Intergenic
1009287808 6:61844097-61844119 TTCTGTTTCTAGAAGACTACTGG + Intronic
1009467017 6:63983873-63983895 ATCTGCTTCAAGAAGAAAAAAGG + Intronic
1010377916 6:75194533-75194555 ATTTGATTCTATAAGATCAAAGG + Intronic
1010685326 6:78847787-78847809 ATATGATCCTAGAATAGTACAGG + Intergenic
1013322778 6:109011024-109011046 CTCTGGTTCTAGAAGAGTTGAGG + Intronic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014688520 6:124532935-124532957 ATCTTTTTCCTGAAGAGTAAGGG - Intronic
1015579008 6:134703182-134703204 ATTTCATTCTAAAAGACTAATGG + Intergenic
1016178198 6:141107112-141107134 ATCTCATTTTAAAACAGTAATGG + Intergenic
1016786601 6:148017395-148017417 ATGTGATTCAAGAAGATAAAGGG + Intergenic
1020819898 7:12954197-12954219 ATGTGAGTCTGGAGGAGTAAGGG + Intergenic
1021362210 7:19729578-19729600 ATCTCATTCTAGAATAGTAAAGG + Intronic
1022914865 7:34938011-34938033 ATTACATTCTAGAAGAGTCATGG - Exonic
1028357106 7:89923880-89923902 ATCACATTTTGGAAGAGTAAAGG - Intergenic
1029375598 7:100175362-100175384 ATCTGCTTCAAGAAGACCAAGGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1029882080 7:103824986-103825008 AGGTGGTTCTAGGAGAGTAAAGG + Intronic
1031412912 7:121461775-121461797 ATCTGAGTCTAATAAAGTAAGGG - Intergenic
1033529848 7:142250844-142250866 ATGTGATGCTAGGACAGTAACGG - Intergenic
1033822237 7:145148490-145148512 ATGTGGTTCTAGAAAAGTAAGGG - Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1034368054 7:150569185-150569207 ATCTGATTGTAGAGTAGAAAAGG + Intronic
1037267179 8:17076445-17076467 ATCTGATTATAGAATAGGAATGG - Intronic
1037933037 8:22894963-22894985 ATCTGATTCTAGAATAGGTCAGG - Intronic
1038129564 8:24714871-24714893 ATCTGATTTTCCAAAAGTAAAGG - Intergenic
1041992866 8:64015335-64015357 ATTTGATTCTAGAAGGGGTAAGG + Intergenic
1042377982 8:68077711-68077733 TGCTGATTCTAGAAGAACAATGG + Intronic
1042750795 8:72155497-72155519 ACCAAAGTCTAGAAGAGTAATGG - Intergenic
1042762647 8:72287436-72287458 ATCAAAGTCTAGAAGAGTAGTGG - Intergenic
1042962296 8:74316562-74316584 ATCAGTTTCTCCAAGAGTAAAGG - Intronic
1045130097 8:99141499-99141521 ATGTAATTCTAGAAATGTAATGG + Intronic
1045783343 8:105894237-105894259 ATATCATTCTAGAAAAATAAGGG + Intergenic
1048794390 8:138136350-138136372 ATTGGATTCTGGAAGAGAAAGGG + Intronic
1049512122 8:143033437-143033459 ATCTATTTATAGAAGAGTTAAGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1055765102 9:79654256-79654278 ATCTGATTCTGATAGAGAAATGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056015714 9:82385066-82385088 ATCTGAAACTTGAAAAGTAATGG - Intergenic
1056179100 9:84064304-84064326 ATCTGAGAGTTGAAGAGTAATGG - Intergenic
1059985921 9:119820475-119820497 AACTGTTTCTAGAAGGGTCAGGG + Intergenic
1061830462 9:133289928-133289950 ATCTTAACCTAAAAGAGTAATGG - Intergenic
1186592839 X:10949842-10949864 AGCTGGCTCTAGAAGATTAATGG + Intergenic
1188101650 X:26095472-26095494 ATATGATTCTATAAAAGGAAAGG + Intergenic
1190064591 X:47231280-47231302 ATCTGATTCTAGCCAAGAAATGG - Intergenic
1190844382 X:54178050-54178072 ATCTGCTTCTTTAAGAATAATGG + Intronic
1190851584 X:54249060-54249082 ATCTGATTCCAGGACAGTAGTGG + Exonic
1193500002 X:82263694-82263716 ATACTATTCTAGAAGAATAAGGG - Intergenic
1194501423 X:94686178-94686200 CTCTGATTAAAGAAGAGTCAGGG - Intergenic
1195152605 X:102087486-102087508 ATGTGATTCTAGATGAAAAAAGG + Intergenic
1198413725 X:136397751-136397773 ATCTGGTTTTAGAAGAGCTATGG + Intronic
1198897261 X:141469282-141469304 ATGTGAATCTATAACAGTAAAGG - Intergenic
1199335287 X:146612126-146612148 ATATGATTCTAGAAAAGGAGAGG + Intergenic
1201928888 Y:19319682-19319704 ATCTGGTTGTTGAAGAGTATAGG - Intergenic