ID: 902499832

View in Genome Browser
Species Human (GRCh38)
Location 1:16902878-16902900
Sequence CTAACGGCATGGAATGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 2, 1: 8, 2: 1, 3: 5, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902499824_902499832 29 Left 902499824 1:16902826-16902848 CCAGCATTTATTTTTGTCTGGAG 0: 6
1: 5
2: 2
3: 26
4: 379
Right 902499832 1:16902878-16902900 CTAACGGCATGGAATGATGAAGG 0: 2
1: 8
2: 1
3: 5
4: 80
902499828_902499832 -5 Left 902499828 1:16902860-16902882 CCATGGTCCTGTAAATGTCTAAC 0: 4
1: 2
2: 1
3: 30
4: 177
Right 902499832 1:16902878-16902900 CTAACGGCATGGAATGATGAAGG 0: 2
1: 8
2: 1
3: 5
4: 80
902499827_902499832 -1 Left 902499827 1:16902856-16902878 CCATCCATGGTCCTGTAAATGTC 0: 4
1: 2
2: 16
3: 127
4: 1954
Right 902499832 1:16902878-16902900 CTAACGGCATGGAATGATGAAGG 0: 2
1: 8
2: 1
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902499832 Original CRISPR CTAACGGCATGGAATGATGA AGG Intronic
902452650 1:16507327-16507349 CTAACAGCATGGAATGATGAAGG - Intergenic
902472710 1:16659990-16660012 CTAACAGCATGGAATGATGAAGG - Intergenic
902486094 1:16747453-16747475 CTAACAGCATGGAATGATGAAGG + Intronic
902499832 1:16902878-16902900 CTAACGGCATGGAATGATGAAGG + Intronic
906559589 1:46746553-46746575 CTAATGGCATTAAATAATGAAGG + Intergenic
908107210 1:60857317-60857339 CTAAGGGCAAGGACTGAAGAGGG - Intergenic
910131261 1:83909795-83909817 CTAATGGCATGAACTGATGGGGG - Intronic
914004705 1:143722259-143722281 CTAACAGCATGGAATGATGAAGG - Intergenic
914096623 1:144549757-144549779 CTAATGGCATGGAATGATGAAGG - Intergenic
914097005 1:144552574-144552596 CTAATGGCATGGAATCATGAAGG - Intergenic
914267800 1:146052864-146052886 CTAATGGCATGGAATGATGAAGG - Intergenic
914301985 1:146385036-146385058 CTAATGGCATGGAATGATGAAGG + Intergenic
921968707 1:221120999-221121021 CTAACTTCATGGAAGGATGGTGG + Intergenic
922238969 1:223743061-223743083 CTAACTGCATGAAATGATTGTGG + Intronic
1063073413 10:2690071-2690093 CTAAGGTCATGCAATGAGGAAGG + Intergenic
1073989426 10:109245667-109245689 TTAACAGGATGCAATGATGATGG - Intergenic
1074989925 10:118695700-118695722 CTAAGGGCAAGGGATGATAATGG + Intronic
1080103960 11:28492054-28492076 TTAATTGAATGGAATGATGATGG + Intergenic
1080123665 11:28705779-28705801 CTCAAGGCCTGGCATGATGAGGG - Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1084277666 11:68062908-68062930 CTAAGTGCGTGGAAAGATGAGGG + Intronic
1085352640 11:75809671-75809693 CTGACGGCATAGAATGAGGCTGG - Intergenic
1085456467 11:76668216-76668238 CTGACGGCATGGATGGGTGAAGG - Intronic
1086753455 11:90528849-90528871 CCAGCTGCATGGAAGGATGAAGG + Intergenic
1087671973 11:101117576-101117598 CTAAAAGTATGGAAAGATGATGG - Intronic
1093962439 12:25289487-25289509 CTAACAACATCGAATGTTGAAGG + Intergenic
1095521039 12:43066515-43066537 CAAATGGCATGAAGTGATGATGG + Intergenic
1104359471 12:128118242-128118264 CTAATGCCATGGAATGGGGAAGG + Intergenic
1108556922 13:51602660-51602682 CTAGCTGCAAGGAAGGATGAGGG + Intronic
1109185670 13:59264811-59264833 CTCACCACCTGGAATGATGAAGG + Intergenic
1109678877 13:65719553-65719575 CTAACTTCATGGAATGATTTTGG - Intergenic
1110693330 13:78457732-78457754 CTAAGGGCAGGGAATGCTGAGGG - Intergenic
1116780082 14:49227541-49227563 CCAACGGCATCAAATGGTGAAGG - Intergenic
1119375540 14:74188938-74188960 CTAACGTCTAGGGATGATGAAGG - Intronic
1122250177 14:100433189-100433211 CTAAAGAGATAGAATGATGAAGG - Intronic
1124504811 15:30263604-30263626 CTACTGGAATGAAATGATGAAGG - Intergenic
1124738741 15:32275031-32275053 CTACTGGAATGAAATGATGAAGG + Intergenic
1138627055 16:58260836-58260858 TTAACAGCATGAAGTGATGAAGG + Intronic
1141126681 16:81405706-81405728 CTAACGTCATCCATTGATGAGGG - Intergenic
1143901207 17:10176114-10176136 CTGAAGGCAGGGAAGGATGAAGG + Intronic
1148506508 17:48131522-48131544 ATAACTGCATGGAATGAAAAGGG - Intergenic
1153140162 18:1962312-1962334 CAAACCACATGGAATGAGGAGGG + Intergenic
1158614701 18:58975934-58975956 CTAAAGTCTTAGAATGATGACGG + Intronic
1202705103 1_KI270713v1_random:16810-16832 CTAACAGCATGGAATGATGAAGG - Intergenic
1202709440 1_KI270714v1_random:9389-9411 CTAACGGCATGGAATGATGAAGG + Intergenic
930216207 2:48700029-48700051 TTGACAACATGGAATGATGATGG + Intronic
939873688 2:147552766-147552788 CTAACTCCATGTAATGATAATGG - Intergenic
939923203 2:148142350-148142372 CTAAGGGCAAGGAATGTGGATGG + Intronic
944935138 2:204560427-204560449 CAAATGGCATGGTATGATCAAGG + Intronic
947257601 2:228182678-228182700 CTCAAGGCTTGGCATGATGATGG + Intergenic
947522255 2:230856061-230856083 CTAAAGGCAAGAAATCATGATGG - Intergenic
1177889297 21:26785778-26785800 CAAATGGCTGGGAATGATGAGGG - Intergenic
1182540625 22:31039209-31039231 CTTACGGGATGGAAGGAGGAGGG - Intergenic
1183707932 22:39486471-39486493 TAAAGGGCATGGAATAATGAAGG + Intronic
949217918 3:1593377-1593399 CTAGCTTCATGGAATGATGTGGG - Intergenic
949790019 3:7782519-7782541 CAAACTGAATGAAATGATGAAGG + Intergenic
950332325 3:12166207-12166229 CTAACAGTATTGAATGATAAGGG + Intronic
952067072 3:29583440-29583462 CTTACTTCATGGAATTATGATGG - Intronic
953807470 3:46083342-46083364 CTAAGAGCATGGAATGTTGAAGG + Intergenic
955537747 3:59942298-59942320 GCAAAGGCATGGAAAGATGAAGG - Intronic
962981841 3:140497812-140497834 CTGATGGCATGGACTCATGAGGG + Intronic
970303393 4:14705019-14705041 TTAAGGCCATGGAAAGATGATGG - Intergenic
970739629 4:19220257-19220279 CTAATGGAATGGAAGGAAGAAGG + Intergenic
971634559 4:29040579-29040601 CTAAGAACAGGGAATGATGAAGG - Intergenic
976995474 4:91427011-91427033 CTAACATCATAGAATAATGATGG + Intronic
978604098 4:110460380-110460402 CTAGAGGTATGGAATGATGATGG + Intronic
983506996 4:168564324-168564346 CTAACGTCATGGTAGGTTGAAGG - Intronic
984181120 4:176483615-176483637 CTAACCTCATGGATTGATAAAGG + Intergenic
984316450 4:178137654-178137676 CGAACCGTATGGAATGATGCCGG + Intergenic
987457051 5:18160701-18160723 ATAAAGGGATGGAATGATGTAGG - Intergenic
993122327 5:83791072-83791094 CTTATGGCATAGAATGATGAAGG + Intergenic
999327693 5:150653314-150653336 CAAACGGGATTGAATGTTGAGGG - Exonic
1006338691 6:33433886-33433908 CTAGGGGCATGGAATAATGAGGG - Intronic
1011739781 6:90348225-90348247 CTAAGGGCATGGCATGGTCAGGG + Intergenic
1016826540 6:148393529-148393551 CAAACACCATGGGATGATGATGG - Intronic
1021481646 7:21124392-21124414 CTAGGGGCAAGGAATTATGACGG - Intergenic
1022369480 7:29757354-29757376 CTCTCTGCATGGGATGATGAGGG - Intergenic
1028969502 7:96841960-96841982 ATAAAGGCAAGGAATGAGGAGGG - Intergenic
1029588608 7:101492039-101492061 CTGCTGGGATGGAATGATGAGGG + Intronic
1031913132 7:127538391-127538413 ATAACGTCAAAGAATGATGAGGG + Intergenic
1033075920 7:138250431-138250453 CTAAGGGTGTGGGATGATGATGG + Intergenic
1038922185 8:32097002-32097024 CTGAAGGCAGGGAAGGATGAGGG - Intronic
1039990698 8:42485192-42485214 CTCACTGCATGGAATGTTCAGGG + Intronic
1040784809 8:51153250-51153272 GTTACGGCCTGGGATGATGAAGG + Intergenic
1046398354 8:113671260-113671282 CTAATGGCTTTGAAAGATGAAGG - Intergenic
1048310648 8:133320058-133320080 CTAATTGCATGAAATGATGTAGG - Intergenic
1051786465 9:20749972-20749994 CTAACAGAATGGAGTGAGGAAGG - Intronic
1052487852 9:29126104-29126126 CTAAGGGCATGGGATGAGAAGGG - Intergenic
1052820574 9:33135279-33135301 GTTGCGGAATGGAATGATGATGG + Exonic
1058683521 9:107460680-107460702 CTAACTGGATGGATTGGTGAAGG + Intergenic
1185689065 X:2138231-2138253 ACAATGGCATGGTATGATGATGG - Intergenic
1186555338 X:10552142-10552164 CAAACAGCATGCAATTATGAAGG + Intronic
1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG + Intergenic
1193549088 X:82867658-82867680 CTAGCGTCATGGAATGATTTAGG + Intergenic
1193907618 X:87261925-87261947 CTAATGGCCTGGGATGATGGTGG + Intergenic
1198552843 X:137762696-137762718 CTAACGGCAGGGATTGGGGAAGG - Intergenic