ID: 902505428

View in Genome Browser
Species Human (GRCh38)
Location 1:16936730-16936752
Sequence GAGCCGGGCCGAGGCAGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 393}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902505425_902505428 -8 Left 902505425 1:16936715-16936737 CCTACGGCTGGCAGAGAGCCGGG 0: 1
1: 1
2: 2
3: 13
4: 168
Right 902505428 1:16936730-16936752 GAGCCGGGCCGAGGCAGCCCTGG 0: 1
1: 1
2: 4
3: 29
4: 393
902505421_902505428 10 Left 902505421 1:16936697-16936719 CCTGGGACTGAGCACGGGCCTAC 0: 1
1: 0
2: 3
3: 10
4: 111
Right 902505428 1:16936730-16936752 GAGCCGGGCCGAGGCAGCCCTGG 0: 1
1: 1
2: 4
3: 29
4: 393
902505418_902505428 22 Left 902505418 1:16936685-16936707 CCAGGAGGCGGGCCTGGGACTGA 0: 2
1: 1
2: 3
3: 59
4: 1446
Right 902505428 1:16936730-16936752 GAGCCGGGCCGAGGCAGCCCTGG 0: 1
1: 1
2: 4
3: 29
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902505428 Original CRISPR GAGCCGGGCCGAGGCAGCCC TGG Exonic