ID: 902506775

View in Genome Browser
Species Human (GRCh38)
Location 1:16943819-16943841
Sequence CAGGTAGAAGAGGCCGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 329}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902506775_902506786 28 Left 902506775 1:16943819-16943841 CCTAGCTCGGCCTCTTCTACCTG 0: 1
1: 0
2: 2
3: 27
4: 329
Right 902506786 1:16943870-16943892 CTCCATCCACTCCAAGTGGGCGG 0: 1
1: 2
2: 0
3: 12
4: 147
902506775_902506784 25 Left 902506775 1:16943819-16943841 CCTAGCTCGGCCTCTTCTACCTG 0: 1
1: 0
2: 2
3: 27
4: 329
Right 902506784 1:16943867-16943889 CACCTCCATCCACTCCAAGTGGG 0: 1
1: 1
2: 0
3: 14
4: 207
902506775_902506780 -10 Left 902506775 1:16943819-16943841 CCTAGCTCGGCCTCTTCTACCTG 0: 1
1: 0
2: 2
3: 27
4: 329
Right 902506780 1:16943832-16943854 CTTCTACCTGGTAGGGTGCTTGG 0: 2
1: 0
2: 1
3: 7
4: 156
902506775_902506783 24 Left 902506775 1:16943819-16943841 CCTAGCTCGGCCTCTTCTACCTG 0: 1
1: 0
2: 2
3: 27
4: 329
Right 902506783 1:16943866-16943888 GCACCTCCATCCACTCCAAGTGG 0: 2
1: 1
2: 1
3: 16
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902506775 Original CRISPR CAGGTAGAAGAGGCCGAGCT AGG (reversed) Intronic
900377010 1:2359458-2359480 CAGGTGGAGGTGGCGGAGCTGGG + Intronic
900686407 1:3950956-3950978 CAGCTACAAGAGGCTGAGCAGGG + Intergenic
901187779 1:7386248-7386270 CAGGCCCAAGAGGCAGAGCTCGG + Intronic
901215058 1:7550544-7550566 CAGGTAGGAGGGGCCCAGGTGGG - Intronic
901215065 1:7550559-7550581 CAGGTAGGAGAGGGCCAGGTAGG - Intronic
901763129 1:11483496-11483518 CAGCGAGAAGAGGCCAAGCTGGG + Intronic
902447901 1:16478682-16478704 CAGGTAGAAGAGGCCAGGTTAGG + Intergenic
902467802 1:16628906-16628928 CACGTAGAAGAGGCCAGGCTAGG + Intergenic
902506775 1:16943819-16943841 CAGGTAGAAGAGGCCGAGCTAGG - Intronic
902624636 1:17669513-17669535 CAGCTAGAAGAGGCAGGGTTGGG + Intronic
903589589 1:24444593-24444615 CAGCCAGAAGAGGCAGAACTAGG + Intronic
903825262 1:26140278-26140300 CAAGCAGAAGAGGCCGGGCATGG + Intergenic
904182686 1:28677891-28677913 AAGGGAGAAGAGGCCGGGCATGG + Intronic
904332366 1:29768483-29768505 CAGGGAGAAGAGGCTGAGGCAGG + Intergenic
904477942 1:30776692-30776714 GGGAAAGAAGAGGCCGAGCTGGG + Intergenic
904910736 1:33932346-33932368 CCCAGAGAAGAGGCCGAGCTGGG + Intronic
905006632 1:34715119-34715141 CAGCTAGAAGAGGCAGACCTGGG - Intronic
906128370 1:43441517-43441539 CAGCTAGAAGAGGGTGAGGTGGG + Exonic
906213020 1:44022632-44022654 CAGATAGAAGATCCTGAGCTTGG + Intronic
908398767 1:63750679-63750701 CATGTAGTAGACACCGAGCTAGG + Intergenic
910131639 1:83914618-83914640 GAGGTGGAAGAGGCAGAGCACGG - Intronic
911287869 1:96019457-96019479 TAGGTAGCAGAGGCCAAGGTAGG + Intergenic
915398194 1:155602042-155602064 AAGGCAGAAGAGGCCGGGCGCGG - Intergenic
915450664 1:156002834-156002856 CAGGTACAAGAAGCCATGCTGGG + Intronic
915650522 1:157307269-157307291 CAGGTAGAGGAGGCTGAGAGAGG + Intergenic
916053190 1:161050147-161050169 TAGGTAGAAGTAGCAGAGCTAGG - Intronic
917041075 1:170807116-170807138 CAGGAAGAAGGGGCCCAGGTTGG + Intergenic
918302922 1:183220327-183220349 CAGGTACAAGAGTCAGAGATGGG + Intronic
918422661 1:184379762-184379784 CAGCTATAAGTGGCAGAGCTGGG - Intergenic
920309332 1:205039493-205039515 CAGGTAGGAGTGACAGAGCTGGG + Intergenic
922073028 1:222215232-222215254 CATGTAGATGAGGCCACGCTGGG - Intergenic
922162889 1:223091190-223091212 GAGGTAGAACTGGCCCAGCTTGG + Intergenic
922987474 1:229877143-229877165 CTGGTAGTAGAGGCCGGGCACGG + Intergenic
923204347 1:231743387-231743409 CAGCTAGAAGTGGCAGAGGTGGG + Intronic
923705505 1:236341199-236341221 AAGGAAGAATAGGCCGGGCTTGG - Intergenic
924126005 1:240852491-240852513 CAGGTAGTAGAGGCATACCTTGG - Intronic
924138620 1:240998759-240998781 CAGGTAGATGCAGGCGAGCTGGG + Intronic
1063478583 10:6350283-6350305 CAGGAAGAAGAGGCTGAGGTAGG - Intergenic
1063623287 10:7667430-7667452 CAGGGAGGCGAGGCCGGGCTTGG - Intergenic
1064031345 10:11885296-11885318 CAGATGGAAGAGGCCGAGCTGGG + Intergenic
1064031359 10:11885335-11885357 GAGATGGAAGAGGCGGAGCTGGG + Intergenic
1069341922 10:67420445-67420467 CAGCTGGAAAAGGCAGAGCTGGG - Intronic
1069630743 10:69895633-69895655 CAGGGAGATGAGGCTGAGCTGGG - Intronic
1070542510 10:77426486-77426508 CAGTTATAAGAGGTTGAGCTGGG + Intronic
1071137153 10:82466182-82466204 CAAGTAGAAGAGACAGAGGTTGG - Intronic
1075723925 10:124602207-124602229 CAGCCAGAAGTGGCAGAGCTGGG - Intronic
1076027124 10:127124753-127124775 TAGGTAGAAGATGCCAATCTTGG - Intronic
1076160986 10:128244188-128244210 CAGGCAGAGAAGGCAGAGCTGGG - Intergenic
1076520696 10:131079094-131079116 CAGGCTGGACAGGCCGAGCTAGG + Intergenic
1077015233 11:396367-396389 CGGGTAGAGGAGGCACAGCTGGG + Intronic
1077556351 11:3227910-3227932 CTGGGAGACGAGGCTGAGCTGGG - Exonic
1080421673 11:32116486-32116508 CATTTTGAAGAGGCTGAGCTGGG + Intergenic
1081525648 11:43925752-43925774 CAGCTAGAAAGGGCAGAGCTGGG - Intronic
1082260431 11:50073385-50073407 CAGGAGGAAGAGGAAGAGCTGGG + Intergenic
1082864805 11:57888744-57888766 CAGGTTGCAGAGGCCGACATAGG + Intergenic
1082957514 11:58885935-58885957 CAGGTAGAAGACACCATGCTTGG - Intronic
1083152131 11:60798554-60798576 CAGGGAGAAGGGGCCAAGCGTGG - Intronic
1083328331 11:61885056-61885078 CAGTTAGTAGTGGCAGAGCTGGG + Intronic
1083330993 11:61898287-61898309 CTGGGGGAAGAAGCCGAGCTTGG + Exonic
1083455861 11:62778198-62778220 CTGGTGGAAGAGGCAGAACTTGG + Intronic
1083609885 11:63999684-63999706 CAGGTAGCAGCTGCGGAGCTCGG + Exonic
1083765628 11:64840173-64840195 CAGGTAGAACTGGGCCAGCTCGG + Exonic
1084838529 11:71825757-71825779 CAGGTAGAAGAGCTTGAGCAGGG + Intergenic
1085264645 11:75230007-75230029 CAGGCAGGAGAGGCTGAGCCAGG - Intergenic
1085685349 11:78616738-78616760 AAGGTAAATGAGGCCAAGCTTGG - Intergenic
1087923217 11:103890622-103890644 CAGGTAGAAGAGGCCAGTCCGGG - Intergenic
1087964179 11:104392207-104392229 AAGGTAGAATATGCCAAGCTAGG + Intergenic
1088550548 11:111008739-111008761 CAGCTAGAAGCGGCAGAGCTGGG - Intergenic
1089119546 11:116124150-116124172 CAGGTAGTAGAGGCTGAGCCTGG - Intergenic
1089187792 11:116632382-116632404 CAAGAAGGAGAGGCCAAGCTGGG - Intergenic
1089390189 11:118096491-118096513 AAGGTAGAAGGGGCCGGGCATGG + Intronic
1090128655 11:124116561-124116583 CTGGTAGAACAGGCTGGGCTGGG - Exonic
1090283345 11:125477583-125477605 CAGGTAGAGGCGGCAGGGCTTGG - Intronic
1093432039 12:19095209-19095231 CAGCTAGAAGAGGCAGAGCCAGG + Intergenic
1093462476 12:19419249-19419271 CAGGTGGAAGCGGCGGCGCTGGG - Intronic
1094681254 12:32669239-32669261 CAGGAAGAAGAGGCTGGGCACGG + Intergenic
1095943518 12:47740895-47740917 CAGGTATGGGAGGCAGAGCTGGG - Exonic
1095973014 12:47917588-47917610 CAGCTAGAAGTAGCAGAGCTAGG + Intronic
1096284288 12:50284644-50284666 CAGGTACAAGGGGCCGGGCGCGG + Intergenic
1096333571 12:50735794-50735816 AAGCTAGGAGAGGCCGAGATGGG + Intronic
1096515753 12:52154255-52154277 CAGGTAGGAGAGGCCAGGCCAGG + Intergenic
1098561645 12:71879423-71879445 CAGGTAAGGGAGGCCGAGCGAGG - Intronic
1098753114 12:74321564-74321586 CAGGAAGTGGAGGCAGAGCTGGG - Intergenic
1100245950 12:92757133-92757155 CAGGCAGAAAAGGCTGAGCAGGG - Intronic
1100376318 12:94019097-94019119 CATGTTGAAGATGCTGAGCTTGG - Intergenic
1100615458 12:96228127-96228149 AAAGAAGAAGAGGCCGAGCATGG + Intronic
1101517317 12:105448832-105448854 CAGCTAGAAGAGGCTAAGCCAGG + Intergenic
1101746774 12:107547726-107547748 GAGCTACAAGAAGCCGAGCTGGG - Intronic
1101819250 12:108170816-108170838 CAGCTAGGAGTGGCTGAGCTGGG + Intronic
1102843574 12:116152992-116153014 CAGGTAGAACACGCCCAGGTAGG + Intronic
1103366651 12:120389106-120389128 CGGGAAGGTGAGGCCGAGCTGGG + Intergenic
1103461508 12:121108369-121108391 CAGTTCCAAGAGGCCTAGCTTGG + Intergenic
1103939067 12:124492178-124492200 CAGGGGGAAGAGGCCCTGCTTGG + Intronic
1103983054 12:124749260-124749282 CACTTAGAAGAGGCTGAGGTGGG - Intergenic
1104705859 12:130946846-130946868 CAGGGAGAAGAGGCCGAGATGGG + Intergenic
1107525449 13:41226829-41226851 TAGGAGGAAGAGGCCAAGCTCGG - Intronic
1108236507 13:48413157-48413179 CAGGAAGAAGAGGCTGGGTTTGG + Intronic
1109397420 13:61778434-61778456 AAGGTAGTAGAGGCCCAGCTTGG + Intergenic
1112599126 13:100838023-100838045 CAGAGAGAAGAGGCTGAGCTAGG + Intergenic
1113111052 13:106823958-106823980 CATGAAGAAGAGGCCGGGCGCGG - Intergenic
1114539309 14:23443063-23443085 CAGGTAACAGAGGCTGAGGTGGG - Intergenic
1115455965 14:33602596-33602618 CATATAGAAGAGGCAGAGCAAGG - Intronic
1115798763 14:36968826-36968848 CAGGGAGAAGAGGCTCAGCAAGG + Intronic
1118630448 14:67697642-67697664 TAGGTCAAAGAGGCAGAGCTGGG + Intergenic
1118785839 14:69044736-69044758 CAGGTCTAAGAGGCCAAGCTAGG - Intergenic
1118959929 14:70519812-70519834 TTGGTACAAGAGGCCTAGCTTGG - Intergenic
1121089328 14:91170318-91170340 CAGCTAGAAATGGCTGAGCTGGG - Intronic
1121549518 14:94788115-94788137 TAGTTAAAAGAGGCAGAGCTGGG - Intergenic
1122013173 14:98770393-98770415 CAGGTAGATGACGCTGAGCCAGG - Intergenic
1122496177 14:102157148-102157170 CAGCTACAAGAGGCTGAGGTGGG + Intronic
1122734765 14:103831599-103831621 AAGGCAAAAGAGGCCGAGCATGG - Intronic
1123710063 15:22980419-22980441 CGGGAGGAAGAGGCCGAGCCGGG - Intronic
1124796330 15:32784244-32784266 CAGGGAGAAGAGGCAGAATTAGG + Intronic
1125196829 15:37056861-37056883 CAGAATAAAGAGGCCGAGCTAGG + Intronic
1125718823 15:41835452-41835474 CAGGGAGAAGAGGCAGAGGTTGG - Intronic
1126102279 15:45126145-45126167 CAGGTAAGAGAGGATGAGCTTGG - Intronic
1126579462 15:50229897-50229919 CATGTAGAAGTGTCAGAGCTTGG - Intronic
1127332475 15:57952407-57952429 CAGAGAGGAGAGGCCAAGCTCGG - Intergenic
1128207981 15:65869764-65869786 GGGGGAGAAGAGGCTGAGCTGGG - Intronic
1128390325 15:67178320-67178342 CAGGCAGAAGAGAAAGAGCTAGG - Intronic
1128536845 15:68498072-68498094 CAGCTAGAAAGGGCAGAGCTGGG + Intergenic
1128560925 15:68667221-68667243 CAGGTAGAAGAGACCGGGGCTGG - Intronic
1129216997 15:74106283-74106305 CAGGTGGTAGAAGCTGAGCTAGG - Intronic
1129688578 15:77700320-77700342 CTGGGAGAAGGGGCAGAGCTGGG + Intronic
1130513378 15:84607275-84607297 CTGGTAGAAGTGGAAGAGCTGGG - Intronic
1131491464 15:92866894-92866916 CAGGAAGAAGAGGGAGAGTTGGG + Intergenic
1131730545 15:95275468-95275490 CAGGCAGAATAGGCCGGGCGTGG + Intergenic
1132036166 15:98486826-98486848 CAGCTAGAAGGGGCTGAGGTGGG + Intronic
1132677095 16:1125325-1125347 CAGTGAGGAGAGGCCGTGCTGGG - Intergenic
1136007694 16:27342217-27342239 CTGGTACAACAGGCGGAGCTCGG - Exonic
1138281383 16:55774433-55774455 CAGGCAGAACAGGCGGAGCGCGG + Intergenic
1138536211 16:57661732-57661754 CAGGCTGAAGAGGCCCAGGTTGG - Exonic
1139182476 16:64764365-64764387 CAGCTAAAAGTGGCCGAGTTGGG - Intergenic
1139512035 16:67432991-67433013 CAGGTACTAGTGGCCTAGCTGGG + Intronic
1141102932 16:81211192-81211214 CAGGCAGCAGGGGCTGAGCTGGG + Intergenic
1141167160 16:81668500-81668522 CACCTGGAAGAGGCCGAGCACGG + Intronic
1141664370 16:85458331-85458353 CAGGTAAATGAGGCCCTGCTTGG + Intergenic
1141768461 16:86074031-86074053 CAGGTGGAAGAGGCCAGGCTGGG - Intergenic
1142512998 17:409688-409710 AAGGTACAGGAGGCCGAGCACGG + Intergenic
1142579556 17:932946-932968 CAGGTTCAAGAGGACGGGCTGGG - Intronic
1142720648 17:1773567-1773589 CAGCTAGTACAGGCAGAGCTGGG - Intronic
1143368423 17:6423232-6423254 AAGGAAGAAGAGGCCGGGCGCGG + Intronic
1143902371 17:10183886-10183908 CAGGTAGCAGGGGCTGAGCTGGG + Intronic
1143943794 17:10571644-10571666 CAGTTTAAAGAGGCAGAGCTAGG + Intergenic
1144694199 17:17290535-17290557 AAGGTAGAAGTGGCCGGGCATGG - Intergenic
1144836343 17:18158501-18158523 CCTGCAGAAGAGGCGGAGCTAGG - Exonic
1146094721 17:29918298-29918320 CAGCTAGAAATGGCAGAGCTGGG - Intronic
1146634456 17:34493781-34493803 TAGCTAGAAAAGGCAGAGCTGGG - Intergenic
1146639072 17:34526525-34526547 CAGGCAGCAGAGCCTGAGCTAGG + Intergenic
1146952861 17:36918845-36918867 CAGGAAGAAGTGGCGGGGCTGGG - Intergenic
1147256707 17:39186035-39186057 GAGGAGGAAGAGGCTGAGCTTGG - Intronic
1147386398 17:40084857-40084879 CAGGGAGAAGAGAGTGAGCTCGG + Intronic
1148127228 17:45243086-45243108 CAGGGTGAGGAGGCGGAGCTGGG - Intronic
1148131177 17:45263412-45263434 CTGGGAGAAGAGGCTAAGCTGGG + Exonic
1148650713 17:49248312-49248334 GTGGTAGAAAAGGCAGAGCTTGG + Intergenic
1149313335 17:55417361-55417383 AAGGTAGGAGACGCGGAGCTGGG - Intronic
1150459763 17:65339739-65339761 CAGGTAGAAATGGCAGAGCAGGG - Intergenic
1150661216 17:67081338-67081360 CAGGTAGAAGAGGACAAGAATGG + Intronic
1150822780 17:68449275-68449297 CTGGTAGAAAAGGCAGTGCTTGG - Intronic
1152504426 17:80738190-80738212 CAGGTACACGGGGCCGGGCTGGG - Intronic
1152513262 17:80804680-80804702 CAGCTAGGAGTGGCCGAGCCTGG + Intronic
1153406909 18:4751064-4751086 CAGCCAGAAGAGGCTGATCTGGG - Intergenic
1153666568 18:7371774-7371796 CAGGTGGGTGAGGCCTAGCTTGG + Intergenic
1156469234 18:37367152-37367174 CAGGAGGAAGAGGAGGAGCTAGG + Intronic
1158760897 18:60385391-60385413 CAGATTGAAGAGGCTGTGCTTGG - Intergenic
1160322030 18:77905432-77905454 CAGGTGGAAGAGGCGGCCCTTGG - Intergenic
1161129172 19:2578240-2578262 CAGGTAGCGTAGGCAGAGCTGGG + Intronic
1161217075 19:3099890-3099912 CAGTTACAAGAGGCAGAGGTAGG - Intronic
1161431626 19:4235813-4235835 CAGTTACAAGAGGCTGAGGTGGG + Intronic
1161476341 19:4487906-4487928 CAGGAGGAAGAAGCCAAGCTAGG - Intronic
1162084603 19:8240945-8240967 CAGGTGGCAGGGGCCAAGCTGGG + Intronic
1162329232 19:10017194-10017216 CAGGGAGAAGTGGACGTGCTGGG + Exonic
1162397265 19:10424349-10424371 CAGGTGGAGGCAGCCGAGCTGGG + Intronic
1162425423 19:10592507-10592529 CAGTCAGAAGAAGCAGAGCTGGG + Intergenic
1162726256 19:12691224-12691246 CAGGTAGGAGAGGCACAGCACGG + Exonic
1163958520 19:20665620-20665642 AAGGGAACAGAGGCCGAGCTGGG - Intronic
1164580439 19:29431829-29431851 CAGATGGAAGAGGCTGAGTTTGG + Intergenic
1165403955 19:35618784-35618806 CAGGGAGAGGAGGCAGAGATAGG - Intronic
1165428163 19:35756844-35756866 CAGGTAGTAGGGGGCGAGCGTGG + Exonic
1165739183 19:38195526-38195548 CAGGGAGGAGAGGCCGAGGAAGG - Intronic
1165855678 19:38878289-38878311 CAGGGGGAAGAGGCGGGGCTGGG + Intergenic
1165989001 19:39795290-39795312 CAGGTAGAAGTTGCAGAGATGGG - Intergenic
1166518801 19:43465616-43465638 CAGGTAAGAGGGCCCGAGCTCGG - Exonic
1167324425 19:48815124-48815146 CAGGTAGGGGAGGGCGAGCTAGG + Exonic
925232483 2:2246119-2246141 CAGGTGGAGGAGGCTGAACTAGG - Intronic
926024049 2:9524376-9524398 CAGCTAGAGGAGGCTGAGGTGGG + Intronic
926340822 2:11903033-11903055 CTGGGAGAAGAGGCCTAGGTTGG - Intergenic
927515595 2:23670053-23670075 CAGGAAGGAGAGGCCTAACTGGG - Intronic
929032724 2:37663882-37663904 CAGGCAGAGGAGGCCGGGCGCGG + Intronic
929486882 2:42362525-42362547 CAGGGATAAGTGGCAGAGCTAGG + Intronic
929969863 2:46564810-46564832 CTGGTAGAAGTGTCAGAGCTGGG + Intronic
932298323 2:70645024-70645046 CAGCTAGCAGTGGCAGAGCTGGG + Intronic
934638359 2:96010730-96010752 CAGGTAGACCAGGCCTGGCTGGG + Intergenic
934795296 2:97094681-97094703 CAGGTAGACCAGGCCTGGCTGGG - Exonic
935365103 2:102280627-102280649 CTCTTAGAAGAGGCTGAGCTGGG + Intergenic
935545435 2:104395542-104395564 CAGGTTGATGGGGCCGATCTTGG + Intergenic
936047213 2:109197101-109197123 CAGCTAGTAGAGGCAGAGGTTGG + Intronic
936063361 2:109312525-109312547 CAGGAAGAAGGGGCCCAGCGGGG - Intronic
936397679 2:112141538-112141560 CAGGCAGCAGAGGCCCAGTTTGG + Intronic
936514887 2:113175138-113175160 CAGGGAGGAGAGGCCCAGCCTGG + Intronic
936539939 2:113341643-113341665 CAGGGGGCAGAGGGCGAGCTGGG + Intergenic
936822735 2:116542689-116542711 CAGGTGGAAGCTGCCAAGCTTGG + Intergenic
940770759 2:157837187-157837209 CATGTAACAGAGGCAGAGCTAGG + Intronic
941471055 2:165887440-165887462 AAGGTGGAGGAGGCCGAGATAGG + Intronic
942316580 2:174702006-174702028 CAGATAGATGTGGCAGAGCTGGG - Intergenic
946060911 2:216940844-216940866 CAGGTATAAGTGGCAGAGCTGGG - Intergenic
947745288 2:232503991-232504013 CAGGAACAAGAGGCAGGGCTGGG - Intergenic
948431927 2:237924295-237924317 CAGGTAAAAAAGGCCGGGCGCGG + Intergenic
948515787 2:238503251-238503273 GAGGTGGCAGAGGCCAAGCTGGG + Intergenic
948789076 2:240367974-240367996 CAGCTGGAAGGGGCCCAGCTGGG + Intergenic
948846011 2:240683142-240683164 CAGGTAGGAGGAGCGGAGCTCGG - Intergenic
948847845 2:240691587-240691609 CAGGTAGGAGGAGCGGAGCTCGG + Intergenic
948949624 2:241240541-241240563 CAGGTAGAAGAGTGGGAGCATGG - Intronic
1168808028 20:684335-684357 CAGCTTGAAGAGGCAGAGCCAGG - Intergenic
1169548712 20:6679159-6679181 CAGGTATAAGAGGCCCTACTTGG - Intergenic
1169807684 20:9576356-9576378 CAGGCAGAAGAGGGCAAACTTGG - Intronic
1169842401 20:9954540-9954562 CAGGCAGAAGAGGCTGAGCAAGG + Intergenic
1171092196 20:22295916-22295938 CAGCTAGCAGAGGTGGAGCTGGG + Intergenic
1172586802 20:36091403-36091425 CAGGAAGGAGAGGCAGGGCTTGG - Intergenic
1172833998 20:37861101-37861123 CAGCTAGAGGAGGCAGAGCTAGG - Intronic
1173100285 20:40081432-40081454 TGGGTAGAACAGGCCTAGCTTGG - Intergenic
1174414116 20:50356032-50356054 CAAGAAGGAGAGGCAGAGCTGGG + Intergenic
1174669721 20:52295412-52295434 TAGCTGGAAGAGGCAGAGCTAGG - Intergenic
1175502452 20:59460156-59460178 CAGGGAGAAGAGACTGAGGTTGG + Intergenic
1176037960 20:63049509-63049531 CAGGTACAAGAGGCCGAGTGCGG + Intergenic
1176157979 20:63632309-63632331 CAGGTGGAAAATGCTGAGCTAGG + Intergenic
1176958668 21:15134964-15134986 CAGGTCCCAGAGGCAGAGCTGGG + Intergenic
1177927503 21:27236534-27236556 CAGGTAGGAGAGGGCAAGTTAGG - Intergenic
1178040767 21:28638656-28638678 CAGGTAGAATGAGCTGAGCTGGG - Intergenic
1178808640 21:35860654-35860676 CAGGTAGGAGAGGCGAGGCTGGG + Intronic
1179784094 21:43719872-43719894 CAGGAAGAAGACGCCGAGTGAGG + Intronic
1180027534 21:45176349-45176371 CAGGGAGAGGAGGCTGGGCTAGG - Exonic
1180674198 22:17576061-17576083 AAGGTAGAGGAGGCCGGGCATGG + Intronic
1181634117 22:24166539-24166561 CAGGTGGGAGAGGCCCAGGTTGG + Intronic
1183361393 22:37384985-37385007 CAGGTGGAGGAGGCAGAGCCAGG - Intronic
1183706895 22:39479746-39479768 CAGATAGGAGTGGCAGAGCTGGG + Intronic
1183728026 22:39600232-39600254 CAGATAGAAGAGCCCCAGGTGGG - Intronic
1183931275 22:41237494-41237516 CAGGGAGAAGAGGCTGGGCAGGG + Exonic
1183985678 22:41568942-41568964 CAGGGAGACGCGGCTGAGCTGGG - Intronic
1184599204 22:45532694-45532716 CAGGTACATGAGGCCTAGTTGGG + Intronic
1185364874 22:50432867-50432889 GGGGAAGCAGAGGCCGAGCTGGG + Intronic
949433927 3:4007756-4007778 CAAGCAGAACAGGCAGAGCTGGG + Intronic
949485032 3:4529938-4529960 TAGCTAGAAGTGGCAGAGCTGGG + Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950518467 3:13482100-13482122 CAGTTACAAGAGGCGGAGTTGGG + Intronic
953544711 3:43855945-43855967 CAGGGAGAAGAAGCCTTGCTGGG - Intergenic
953575408 3:44109456-44109478 GAGGTAGAAGCGGTCCAGCTGGG + Intergenic
953819919 3:46198807-46198829 AAGGTAGAAGAGGCTGGGCGTGG + Intronic
954363074 3:50132720-50132742 CAGGGAGAAGGGGCCCAGCCTGG + Intergenic
955679434 3:61485228-61485250 TAGGTAGAAAAGTCCTAGCTGGG + Intergenic
956785647 3:72640093-72640115 CAGCTAGTAGTGGCAGAGCTGGG + Intergenic
957992396 3:87643763-87643785 GAGGTAGAAGAAGGAGAGCTGGG - Intergenic
959484682 3:106913367-106913389 CAGGAAGCAGAGGCCGGGCCAGG + Intergenic
960530143 3:118755215-118755237 CAGGGAGAAGAGGCAGGGCCTGG - Intergenic
960874529 3:122283906-122283928 CAGGGAGAAGAGGAGGAGGTAGG - Exonic
961807732 3:129501322-129501344 CAGGTAGCAGTGGCCCAGCCAGG + Intronic
963041241 3:141071623-141071645 CAGGCATAGGAGGCAGAGCTGGG - Intronic
965816255 3:172639952-172639974 CAGCTAGAAGTGGCAGAACTGGG + Intronic
966822022 3:183932590-183932612 CAGCTAAAAGTGGCAGAGCTAGG - Intronic
968520338 4:1032192-1032214 CAGGAAGGAGAGGCCGGGCCAGG - Intergenic
968910582 4:3475363-3475385 CAGGTAGAGGAGGCAGAGAAGGG + Intronic
969413798 4:7045985-7046007 CTGGTAGAGGAGGCAGAGCCAGG + Intronic
969659039 4:8515653-8515675 CAGGGAGCAGAGGCTGGGCTAGG + Intergenic
969706682 4:8796222-8796244 CAAGCAGCAGAGGCCGAGCACGG - Intergenic
969779949 4:9393239-9393261 CAGGTAGAAGAGTATGAGCAGGG + Intergenic
969909528 4:10430712-10430734 TAGGTAGAAGGGGCCGGGCACGG - Intergenic
972916220 4:43883311-43883333 AAGGTAGTAGAGGCACAGCTTGG + Intergenic
974108585 4:57499884-57499906 AGAGTAGAAGAGGCCGAGTTGGG + Intergenic
974625742 4:64427381-64427403 CAGTTACAGGAGGCCGAGGTGGG - Intergenic
976196872 4:82540957-82540979 CAGCTAGTAGAGACAGAGCTGGG - Intronic
976428716 4:84937360-84937382 CAGGGAGAAGAGGAGGAACTAGG - Intronic
978083564 4:104622672-104622694 CAGGGAAAAGAGCCCGAGCATGG + Intergenic
981091749 4:140739442-140739464 CTGGTAGCATAGGCAGAGCTTGG - Intronic
984488516 4:180402393-180402415 CAGGAAGATGAGGCCGGGCACGG - Intergenic
984812558 4:183807682-183807704 GAGCTGGAAGAGGCTGAGCTGGG + Intergenic
985335764 4:188892015-188892037 TAGCTAGAAGAGGCCGGGCGCGG - Intergenic
985745124 5:1642542-1642564 GAGGTAGAAAGGGCAGAGCTGGG - Intergenic
986786912 5:11123091-11123113 AAGGTAGAAAAGGCAGTGCTTGG - Intronic
987170657 5:15254016-15254038 CATTCAGAAGAGGCAGAGCTGGG - Intergenic
988662261 5:33284448-33284470 CAGCTAGAAGTGGCTGAGCTGGG - Intergenic
990496973 5:56358273-56358295 TTGGTAGAAGAGGCCCAGTTAGG - Intergenic
991167058 5:63575692-63575714 CAGGTAAACAAGGCAGAGCTGGG + Intergenic
991648850 5:68830671-68830693 CAGGGAGCAGAAGCGGAGCTGGG - Intergenic
997436968 5:133882557-133882579 CAGGAAGGAGAGGCAGAGCTGGG - Intergenic
998079158 5:139260378-139260400 GAGGTAGAAGAGCCCAAACTGGG - Intronic
998225882 5:140325900-140325922 GAGGTAGAAGAGGCTGAGCATGG - Intergenic
999046264 5:148473007-148473029 AAGGTAGAAGAGGCTGGGCGCGG + Intronic
999642538 5:153686357-153686379 CAGAGAGAAGAGGCTGAGCAGGG + Intronic
1000626826 5:163548200-163548222 CAGGTAGAAAATGCGGAGTTTGG - Intergenic
1001799093 5:174527948-174527970 GGGGTAGAAGAGGCCGGGCGCGG - Intergenic
1003098075 6:3157556-3157578 CGGGTATAAAAGACCGAGCTGGG - Intergenic
1004068971 6:12279276-12279298 CAGGTAGCAGAGGCAGAGAGGGG + Intergenic
1004625769 6:17375436-17375458 CAGGAAAAAGAGGCTGAGCGCGG - Intergenic
1008751265 6:54736798-54736820 CAGGCAGAAGAGGGAAAGCTGGG + Intergenic
1011621297 6:89245342-89245364 CAGGTATAAATGGCCAAGCTGGG - Intergenic
1013181130 6:107717973-107717995 CAGGCAGAAGGGCCTGAGCTAGG + Intronic
1014725874 6:124971365-124971387 CAAGTAGATGAGGCTGAGTTTGG - Intronic
1016395733 6:143621639-143621661 CAGGTAGAACAGGCTCAGCCAGG - Intronic
1016878812 6:148889858-148889880 CAGGGGGAAGAGGCACAGCTAGG - Intronic
1017750434 6:157486330-157486352 CAGGTAGGAGATGCTGTGCTTGG - Intronic
1018131173 6:160733547-160733569 AAGGAAGAAGAGGCTGAGCATGG + Intronic
1018733291 6:166669224-166669246 CAGGAATATGAGGCAGAGCTGGG + Intronic
1018856291 6:167677671-167677693 CAGGTAGAAGAGAACGTGGTAGG - Intergenic
1018959468 6:168437486-168437508 AAGGAAGAAGAGGCCGGGCGCGG + Intergenic
1019341563 7:511121-511143 CAGGCAGCAGAGGCTGAGCTGGG + Intronic
1019952227 7:4382958-4382980 CAGGTAGAGAAGACAGAGCTGGG - Intergenic
1021095657 7:16532788-16532810 CAGCTGGAAGAGACAGAGCTGGG - Intronic
1021806081 7:24357419-24357441 CAGGTACAAAAGCCTGAGCTGGG - Intergenic
1022175765 7:27870328-27870350 CAGGTAGCAGAGCCGGAGCCAGG - Intronic
1022469487 7:30673564-30673586 CAGGAAGTGGAGGCCAAGCTGGG - Intronic
1023248143 7:38229290-38229312 CAGCTAGACGAGGCAGCGCTGGG + Intronic
1023345134 7:39264146-39264168 CAGGTAGAAGTGGGGAAGCTGGG - Intronic
1024428831 7:49262163-49262185 TGGGGAGAAGAGGCCCAGCTGGG + Intergenic
1027263196 7:76479447-76479469 CAGGGAGCAGGGGCAGAGCTGGG - Intronic
1027314580 7:76977552-76977574 CAGGGAGCAGGGGCAGAGCTGGG - Intergenic
1028724440 7:94071247-94071269 CTGGCAGAAGAGGCAGAGTTTGG - Intergenic
1029080544 7:97970667-97970689 AAAGAAGAAGAGGCCGGGCTCGG - Intergenic
1033661098 7:143402758-143402780 CAGCTATGAGAGGCAGAGCTGGG + Intronic
1034965751 7:155389525-155389547 CAGGTACAAGCGTCCAAGCTGGG + Intronic
1034986936 7:155522130-155522152 CAGGTAGAAGATGCAGCGCCTGG - Intronic
1035556174 8:568972-568994 CAGGAATAAGAGGCCCAGGTGGG + Intergenic
1035600194 8:892738-892760 TGGGTAGGAGAGGCCGAGCCAGG + Intergenic
1036277366 8:7367216-7367238 CAGGTAGAAGAGCATGAGCAGGG + Intronic
1036343964 8:7943119-7943141 CAGGTAGAAGAGCATGAGCAGGG - Intronic
1036690708 8:10943064-10943086 CAGGTAGAAGAGCCCCAGATGGG - Intronic
1036839306 8:12103886-12103908 CAGGTAGAAGAGCATGAGCAGGG - Intergenic
1036861095 8:12350129-12350151 CAGGTAGAAGAGCATGAGCAGGG - Intergenic
1038193066 8:25341647-25341669 CAGGAAGAAAAGGCTGTGCTTGG - Intronic
1038586111 8:28790616-28790638 GAAGTAGAAGAGGCCGATCAGGG - Intronic
1040434701 8:47379257-47379279 AAGTTAGAAGAGGCTGGGCTTGG + Intronic
1041671083 8:60492557-60492579 CAGGGAGAAGAGCCAGAGATTGG - Intergenic
1043939572 8:86181626-86181648 CAAGCAGAAGAGGCTGAGCCAGG - Intergenic
1044236215 8:89833409-89833431 GAGGAAGAAGAGGCTTAGCTAGG - Intergenic
1044426801 8:92061697-92061719 CAGGCAGAAGAGGCTGTGCTTGG - Intronic
1044861075 8:96524617-96524639 CAGGTAGCAGTGGGGGAGCTAGG - Intronic
1048732417 8:137458245-137458267 CAGGTAGAAGAGGCTGATTTTGG + Intergenic
1048878050 8:138852154-138852176 GAGGTAGAAGTGGCCCAGGTTGG + Intronic
1049374345 8:142281865-142281887 CAGGATGAAGGGGCTGAGCTTGG - Intronic
1049604529 8:143523105-143523127 CAGGGAGAAGAGGCCCAGTCTGG - Intronic
1050063236 9:1732152-1732174 CACCTAGAAAAGGCCAAGCTGGG - Intergenic
1051288574 9:15522046-15522068 AAGATAGAAGAGGCAGAACTGGG + Intergenic
1054801367 9:69352629-69352651 TAGCTAGAAGTGGCAGAGCTGGG + Intronic
1054872520 9:70061324-70061346 CAGCTAGAAGTGGCAGGGCTGGG + Intronic
1055038654 9:71845473-71845495 CAGCTACAGGAGGCTGAGCTGGG - Intergenic
1056362547 9:85873553-85873575 AAGGTAGATGAGGCTAAGCTCGG + Intergenic
1059328819 9:113522350-113522372 CAGGGAGAAGAGTCCCTGCTTGG - Intronic
1059588249 9:115629369-115629391 CAGGTAGAAGGGCCCCACCTGGG - Intergenic
1062324007 9:136003956-136003978 CAGGTAGAGGAGGCCTAGGGTGG - Intergenic
1062452566 9:136621719-136621741 CAGGGTGAAGAGGCAGGGCTGGG + Intergenic
1186541023 X:10400182-10400204 AAGGAAGGAGAGGCCAAGCTAGG - Intergenic
1187915503 X:24149673-24149695 GAGGGAGGAGGGGCCGAGCTCGG - Intronic
1188356484 X:29197997-29198019 TGGGTAGAAGAGGCCGGGCACGG - Intronic
1189272364 X:39760363-39760385 TAGACAGAAGAGGCAGAGCTGGG + Intergenic
1189491457 X:41474286-41474308 CAGGTAGAGCAGCTCGAGCTCGG - Exonic
1191740602 X:64432766-64432788 CAGGTGGAAGGGGGCCAGCTGGG + Intergenic
1195134813 X:101894377-101894399 GAGGTAGAAGAGTCACAGCTTGG + Intronic
1196634280 X:117983098-117983120 AAGGCAGAAGAGACAGAGCTAGG + Intronic
1196683589 X:118492960-118492982 GAGGCAGGAGAGGCCGAGCGCGG - Intergenic
1197700395 X:129595284-129595306 CATCTAGAAGTGGCAGAGCTGGG - Intergenic