ID: 902508516

View in Genome Browser
Species Human (GRCh38)
Location 1:16953199-16953221
Sequence CTGAGGGTATGGGGGCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 2, 1: 0, 2: 1, 3: 25, 4: 311}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902508500_902508516 27 Left 902508500 1:16953149-16953171 CCGTCATAGCCCTTATCACTCCC 0: 1
1: 1
2: 0
3: 35
4: 241
Right 902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG 0: 2
1: 0
2: 1
3: 25
4: 311
902508506_902508516 -5 Left 902508506 1:16953181-16953203 CCTGGTCACCCTCCATCTCTGAG 0: 2
1: 0
2: 6
3: 36
4: 344
Right 902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG 0: 2
1: 0
2: 1
3: 25
4: 311
902508504_902508516 7 Left 902508504 1:16953169-16953191 CCCTTGTATTTACCTGGTCACCC 0: 2
1: 0
2: 0
3: 12
4: 107
Right 902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG 0: 2
1: 0
2: 1
3: 25
4: 311
902508499_902508516 28 Left 902508499 1:16953148-16953170 CCCGTCATAGCCCTTATCACTCC 0: 1
1: 1
2: 1
3: 9
4: 121
Right 902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG 0: 2
1: 0
2: 1
3: 25
4: 311
902508498_902508516 29 Left 902508498 1:16953147-16953169 CCCCGTCATAGCCCTTATCACTC 0: 1
1: 1
2: 1
3: 8
4: 90
Right 902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG 0: 2
1: 0
2: 1
3: 25
4: 311
902508502_902508516 17 Left 902508502 1:16953159-16953181 CCTTATCACTCCCTTGTATTTAC 0: 1
1: 1
2: 0
3: 15
4: 214
Right 902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG 0: 2
1: 0
2: 1
3: 25
4: 311
902508505_902508516 6 Left 902508505 1:16953170-16953192 CCTTGTATTTACCTGGTCACCCT 0: 2
1: 0
2: 1
3: 11
4: 129
Right 902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG 0: 2
1: 0
2: 1
3: 25
4: 311
902508501_902508516 18 Left 902508501 1:16953158-16953180 CCCTTATCACTCCCTTGTATTTA 0: 1
1: 1
2: 1
3: 19
4: 272
Right 902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG 0: 2
1: 0
2: 1
3: 25
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902508516 Original CRISPR CTGAGGGTATGGGGGCCAGA TGG Intronic
900183776 1:1323928-1323950 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183781 1:1323944-1323966 CTGAGGGTCTGGGGGTCTGCTGG + Intronic
900183791 1:1323968-1323990 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183798 1:1323984-1324006 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183844 1:1324112-1324134 CTGAGGGTCTGCGGGGCTGAGGG + Intronic
900183865 1:1324152-1324174 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183885 1:1324208-1324230 CTGAGGGTCTGCGGGGCTGAGGG + Intronic
900300241 1:1973449-1973471 GGGAGGGGATGGAGGCCAGAAGG + Intronic
900386460 1:2413084-2413106 CGGTCGGTTTGGGGGCCAGAGGG + Intronic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
901022293 1:6261398-6261420 CTGGGGGCCCGGGGGCCAGAGGG + Intergenic
901191071 1:7410022-7410044 CGAAGGGAATGGGGGCCAGTAGG + Intronic
901823880 1:11847968-11847990 CTGAGGGTCTGGGGGGCTGTTGG - Intronic
901886842 1:12229724-12229746 CTGTGGGTGAGTGGGCCAGACGG + Intergenic
902251650 1:15157363-15157385 CTTAGAATATCGGGGCCAGAGGG + Intronic
902466174 1:16620104-16620126 CTGAGGGTATGGGGGCCAGATGG - Intergenic
902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG + Intronic
902532367 1:17098743-17098765 CTGAGGGTGAAGGGGCCAGAAGG - Intronic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
903578552 1:24354129-24354151 CTGTGAGTGTGGGGGCCAGCAGG + Intronic
903772343 1:25771846-25771868 CTGCGGGCAGCGGGGCCAGATGG + Intronic
904356344 1:29942565-29942587 CACAGGGTCTGGGGGGCAGAGGG + Intergenic
905250680 1:36646386-36646408 CTGAGGGGATGGGAGCAGGATGG - Intergenic
906149995 1:43582124-43582146 CTGAGAATTTGGGGGACAGAAGG - Intronic
906523440 1:46480216-46480238 CTGGGGCTAGGGGGGTCAGAGGG - Intergenic
908640851 1:66221758-66221780 CAGAGGGTGGGAGGGCCAGAGGG - Intronic
910803677 1:91169992-91170014 TTGAGGGTACGGAAGCCAGAAGG - Intergenic
911121281 1:94299735-94299757 CTGGGGATAAGGGAGCCAGAGGG + Intergenic
912635799 1:111291508-111291530 CTGAGGGGTTGGGGGCAAGGGGG + Intronic
913666829 1:121056592-121056614 TTGAGGGGATCGGGGCAAGATGG + Intergenic
914018574 1:143844028-143844050 TTGAGGGGATCGGGGCAAGATGG + Intergenic
915456092 1:156041849-156041871 GTGAGGGTAGGGGGGCAGGAGGG - Intronic
915798695 1:158765691-158765713 CTGAGGATATGGTGGCCCCAGGG - Intergenic
916589522 1:166176826-166176848 CTGAGGGAAAGAGGTCCAGAGGG - Intergenic
920652363 1:207848236-207848258 CTCAGGATCTGGGGGCAAGATGG + Intergenic
922983960 1:229851554-229851576 CAGAGGGCATGGGCGCCTGAGGG - Intergenic
923093916 1:230760087-230760109 CTGAGGGTCTGCGGGTCACACGG - Intronic
923116036 1:230938689-230938711 CTGAGGAGATGAGGGACAGAAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1063823771 10:9869561-9869583 TTGACAGTATGGGGGACAGATGG + Intergenic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1064662916 10:17624182-17624204 CTGAGGGTAAGGTGTCCTGAGGG + Intergenic
1065650975 10:27890822-27890844 TTTAGGATCTGGGGGCCAGATGG + Intronic
1066500284 10:35986852-35986874 CTGATGATAGAGGGGCCAGAAGG + Intergenic
1066628180 10:37431125-37431147 CTGACGATAGAGGGGCCAGAAGG + Intergenic
1067410598 10:46060863-46060885 AAGAGGGTGTGGGGGACAGAGGG - Intergenic
1067834972 10:49632813-49632835 CTGAGGGCATGAGGCCCACAGGG + Intronic
1068665817 10:59674848-59674870 CTGGGAGTGTGGGGGCAAGATGG + Intronic
1070318519 10:75336851-75336873 CTGAGATTAAGGGGGCCACATGG - Intergenic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070960647 10:80497993-80498015 CGGAAGGTCTGGGAGCCAGAAGG - Intronic
1071168625 10:82836215-82836237 TTTAGGCTATGGGGGCCAGAAGG - Intronic
1074008706 10:109455746-109455768 CTGAGGGAGTGGGTGCCAGTGGG - Intergenic
1074769628 10:116724898-116724920 TTCAGGGTCTGGGGGCCAGGTGG - Intronic
1075705334 10:124497182-124497204 CTGAGGGCCTGAGGGCCCGAGGG - Intronic
1076361065 10:129889257-129889279 CAGAGAGCATGGGGGCCAAAGGG + Intronic
1078967999 11:16370029-16370051 CTGAGAGGATGGTGGCCAGCTGG - Intronic
1080231713 11:30023515-30023537 CTGAGAGTATGGGTGTCATAAGG + Intergenic
1081537208 11:44004685-44004707 CTGAGGATAGGGCGGGCAGATGG - Intergenic
1081771194 11:45651437-45651459 CTCAGGGGATTGGGGTCAGATGG - Intronic
1083671705 11:64303677-64303699 TTGGGGGTTTGGGGGCCACAGGG + Intronic
1083887890 11:65581607-65581629 CTGGGGGACTGGGGGCCGGAGGG - Exonic
1084270963 11:68028947-68028969 CTGAGTGGATGGGGCCCAGGAGG - Exonic
1084496660 11:69509129-69509151 CTGATGGTTTGGGGGCAGGAAGG + Intergenic
1087064442 11:94014206-94014228 CTTAGGGAATTGGGGCCAGAAGG + Intergenic
1088718748 11:112573471-112573493 CTGAGGGTCTCTGGGCCATAGGG - Intergenic
1089004034 11:115075772-115075794 CTGTGGGTATAGGGTCAAGATGG + Intergenic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1091697940 12:2640598-2640620 CTGGGAGGAGGGGGGCCAGAAGG + Intronic
1092560177 12:9604509-9604531 GTGAGCGTATGGAGGCCAGATGG - Intronic
1093728662 12:22543978-22544000 CTGAGGGGCTGGGGGCGAGGTGG + Intronic
1094138199 12:27151699-27151721 CTGATGATAGGGGGGCTAGAGGG - Intergenic
1094469621 12:30791648-30791670 CTGAGGGCATTGGGGTGAGATGG - Intergenic
1095870745 12:47025321-47025343 CTGAGGGTTTGGGGGAGGGAGGG - Intergenic
1095975127 12:47935140-47935162 CTGAGGGCACGGGGGCAGGAGGG + Intronic
1100378664 12:94041799-94041821 CTGAGGGGATGCGGGTCACAGGG - Intergenic
1102043778 12:109817169-109817191 CTGCAGGAATGGGGGCCAGGGGG + Intronic
1102227004 12:111235864-111235886 CTCAGGTTTTGGGGGCCAGTGGG + Intronic
1104148630 12:126060123-126060145 ATGAGGGTATGGGGGCCTGGGGG + Intergenic
1104548159 12:129731390-129731412 AAGAGGGTATGGGGGACAGGGGG + Intronic
1104921230 12:132291799-132291821 CTGAGGGTGTGGGGACAGGAGGG - Intronic
1107558987 13:41543915-41543937 CCTGGGGTATGCGGGCCAGATGG - Intergenic
1108288912 13:48937913-48937935 CGGAGGGTATGAGGGCCAATCGG + Intergenic
1110000545 13:70193908-70193930 TTGGGGGTATGGGGGGCAAAAGG - Intergenic
1110028063 13:70568591-70568613 CTGAGGCTATTGGGACCTGAGGG - Intergenic
1111433869 13:88180830-88180852 CTGAGGGTGTGGGGGTGTGATGG - Intergenic
1112369444 13:98782098-98782120 TTGAGTGTATGTGGGACAGAAGG - Intergenic
1113369085 13:109706182-109706204 CTCAGGGTAGGGGGGCCTGTGGG + Intergenic
1113503721 13:110798714-110798736 CTGAGGCTATGGGATCCCGATGG - Intergenic
1114597382 14:23925197-23925219 CGGAGACTATGGAGGCCAGAGGG - Intergenic
1115503843 14:34075278-34075300 CTGAGGGCTTGGGGGCAGGAGGG - Intronic
1117074787 14:52091046-52091068 CTGTGGGTCTGGGGTCAAGAGGG + Intergenic
1117582148 14:57162290-57162312 CTGAGTGTGTGGGGGCCAGGAGG - Intergenic
1117647937 14:57871803-57871825 CTGATGGTCATGGGGCCAGAGGG - Intronic
1117744952 14:58860268-58860290 CTAAGGGTATGGAGTCCAGCTGG + Intergenic
1119216983 14:72876596-72876618 CTGAGGGAAGGAAGGCCAGATGG - Intronic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119720777 14:76888658-76888680 CTGAAGGTATAGGGGACAGCAGG + Intergenic
1119877422 14:78072742-78072764 TTGGGGGGATGGGGGCTAGAAGG + Intergenic
1121099802 14:91242601-91242623 ATGAGGGAATGGGTGGCAGATGG + Intronic
1125144652 15:36452865-36452887 CTGATGGTATGGGGACATGAAGG - Intergenic
1127776529 15:62268282-62268304 CTGAGGGCAGGGGGCCCAAAGGG - Intergenic
1127987239 15:64083329-64083351 CTTAGGGTTTGGAGGTCAGAAGG - Intronic
1127995984 15:64153334-64153356 CTGGGGGTAAGGGGGGCCGATGG + Exonic
1128438069 15:67675435-67675457 CTGAGAGGATGGGAGACAGAGGG + Intronic
1128756415 15:70186613-70186635 ATGATGGGGTGGGGGCCAGAGGG - Intergenic
1129313156 15:74726053-74726075 CTGAGGTCACGGGGGCCGGAAGG + Intergenic
1129666974 15:77584784-77584806 ACGAGGGTGTGGGAGCCAGAGGG - Intergenic
1130135283 15:81176925-81176947 CTGAGGGGCTGGGGGGCACAAGG + Intronic
1130379220 15:83357437-83357459 CTGAGGGTAGGAGGGCCTGGGGG - Intergenic
1131122171 15:89829466-89829488 CCCACGGTATGGGGGTCAGAGGG - Intergenic
1131671777 15:94627385-94627407 GTGGGGGTAGGGGAGCCAGATGG + Intergenic
1131679432 15:94706061-94706083 CGGAGGATATGGGGGGCAGTGGG - Intergenic
1132751927 16:1461572-1461594 CTCAGGGTCAGGGGGACAGAAGG + Intronic
1132995209 16:2819138-2819160 CAGGGGCTGTGGGGGCCAGAAGG + Intronic
1133643877 16:7744640-7744662 CTGAGGGAATGGGAGACACAGGG - Intergenic
1134257892 16:12626589-12626611 CTAAGGGGATGAGGGCCAGGGGG - Intergenic
1135162477 16:20109422-20109444 ATGAGGGGTTGGTGGCCAGATGG + Intergenic
1137897982 16:52234701-52234723 CTTAGGTTTTGTGGGCCAGATGG + Intergenic
1138152900 16:54675665-54675687 TTAAGGGTATGGGGGCCACAGGG + Intergenic
1138244946 16:55460550-55460572 TAGAAGGTGTGGGGGCCAGAGGG - Intronic
1139435204 16:66932878-66932900 CTGAGGGTCTGGGGGCTGCAGGG - Intronic
1141764831 16:86051529-86051551 CTGAGGACTTGGGGGCCAGAGGG + Intergenic
1141920958 16:87135026-87135048 GTGAGTGAATGGGGGACAGAGGG + Intronic
1142007461 16:87696308-87696330 CTCAGGGTGTCGGGGCCACAAGG + Intronic
1142021429 16:87785319-87785341 CTGAGGGTGTCGCAGCCAGAAGG - Intergenic
1143023969 17:3930205-3930227 CTGAGGGTCAGGGGTCCAGGTGG - Intronic
1143101315 17:4506264-4506286 CTGAGGGTTTGTGGGCTTGAGGG + Intronic
1143660048 17:8319074-8319096 CGGAAGGTAGGGGGTCCAGATGG - Exonic
1144541672 17:16148241-16148263 GTGAAGGTCTGGGAGCCAGAGGG - Intronic
1145065279 17:19757669-19757691 CGGAGAGTATGGGGGGCAGCAGG - Intergenic
1145281215 17:21468335-21468357 CCAAGGGCATGGGGGACAGAGGG - Intergenic
1145396117 17:22496420-22496442 CCAAGGGTGTGGGGGACAGAGGG + Intergenic
1146151425 17:30476320-30476342 CTGAAACTATGGAGGCCAGAAGG + Intergenic
1147354045 17:39877339-39877361 ATGAGGGTATGGGGTGCAGTGGG - Intronic
1147721782 17:42543942-42543964 CTGACCTTGTGGGGGCCAGAAGG + Exonic
1148078800 17:44955994-44956016 CTAAGGTTATGGGGACCAGAGGG - Intergenic
1148105181 17:45115056-45115078 CTGGGTGTCTGGGGGCGAGAGGG - Intronic
1148128652 17:45249358-45249380 CTGAGGGTAGAGGGGACAGGTGG + Intergenic
1148683883 17:49490019-49490041 CAGAAGGTATGGGTGCCACACGG + Intergenic
1148863271 17:50615532-50615554 CTGGAGGTGGGGGGGCCAGATGG - Intronic
1151260557 17:72912660-72912682 CTGAGGGTACGGGGGTGAGGAGG + Intronic
1151514091 17:74580985-74581007 CTGAGGGTATTTGGGGGAGATGG + Intronic
1152044932 17:77929567-77929589 CTGCAGGTATTGAGGCCAGAAGG + Intergenic
1152228858 17:79104819-79104841 TTGAGGGTGTGAGGGCAAGAGGG + Intronic
1154193809 18:12251779-12251801 CTGAGGGTGTGGGTGTCAGGTGG + Intergenic
1155647958 18:28103646-28103668 CTCAGGGGATGGGGGCTAGGGGG - Intronic
1156094819 18:33516679-33516701 CTGTAGCTATGGGTGCCAGAGGG - Intergenic
1156158228 18:34329221-34329243 TAGAGGGTATGGGGTCCACATGG + Intergenic
1158116908 18:54005717-54005739 CTGAGGAAGTAGGGGCCAGAGGG + Intergenic
1158219169 18:55132532-55132554 CTGAGGGTCACGGGGCCTGAAGG - Intergenic
1158862151 18:61603173-61603195 CTGAGGCTATAGGGACCAAAGGG + Intergenic
1159004210 18:62998427-62998449 CTGAGAATCTTGGGGCCAGAGGG - Intergenic
1160330231 18:77984439-77984461 ATGAGGGTGTAGGGCCCAGATGG - Intergenic
1160825373 19:1077834-1077856 CTGTGGGTGTGGGAGCCAGGAGG - Intronic
1161186753 19:2926556-2926578 CTGCCGGTGTGGGGGACAGAGGG - Intergenic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1161313845 19:3608832-3608854 GTGAGGGGCTGGGGGGCAGATGG + Intergenic
1162239235 19:9335455-9335477 CTGGGGGTATGGGGGAGACAGGG - Intronic
1162835270 19:13312823-13312845 CTGAGGGTAGGGGTTCCAGGTGG + Intronic
1163554162 19:17983152-17983174 CTGAGGCTCTGGGGGACAAAGGG + Intronic
1163594761 19:18214526-18214548 CAGAGGCTATGGGAGCCACAGGG + Intronic
1163608465 19:18288585-18288607 CAGAGGGTTTGGGGATCAGAAGG + Intergenic
1163847481 19:19645791-19645813 CTGTGGGGATGAGGGACAGATGG + Intronic
1164684236 19:30156610-30156632 ATGAGGGAATGGGGTTCAGAGGG + Intergenic
1164783995 19:30914889-30914911 CTGAAGGTATGGGCCCCAGTGGG - Intergenic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165941133 19:39415304-39415326 CTGGGGTTATGGGGGCCAAGGGG - Intronic
1166120771 19:40684930-40684952 AGGAGGGCATGGGGGCTAGAGGG + Intronic
1166174734 19:41059272-41059294 CCAAGGGTATGGGGGCCACAAGG - Intergenic
1166512127 19:43415982-43416004 CTGTGCGTATGGGGGACATAGGG + Exonic
1166993086 19:46704877-46704899 TTCAGGGTCTGGGGGACAGATGG - Intronic
1166993116 19:46704996-46705018 TTCAGGGTCTGGGGGACAGATGG - Intronic
1168072079 19:53958984-53959006 CTGAGAGGATGGGGGAGAGAGGG - Intergenic
1168179568 19:54652023-54652045 GTGAGGGTAGGGGGTCTAGAGGG - Intronic
925146822 2:1587732-1587754 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925146883 2:1587941-1587963 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925282925 2:2697326-2697348 CTTAGGGTATGCTGGCCAAAGGG - Intergenic
925922142 2:8645309-8645331 CGGAGGGGCTGGGGGTCAGAGGG - Intergenic
926089016 2:10038032-10038054 CTCAGAGTAGGGGGGCCACATGG - Intergenic
927711793 2:25330741-25330763 CAGAGGGCATGGGGGACAGGGGG - Intronic
928020604 2:27701858-27701880 CTGAGAGAGTGGGAGCCAGAGGG + Intergenic
929578214 2:43066014-43066036 CTGAGGGCAGGGGAGCCAGCTGG + Intergenic
929668619 2:43852487-43852509 GTGAGGGCCTGGGGGGCAGATGG + Intronic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
931066812 2:58596834-58596856 CAGAGGCTTTGGGGGTCAGATGG + Intergenic
931750683 2:65327237-65327259 CTGAGGGGATGGGAGCAGGAAGG + Intronic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
932247564 2:70208206-70208228 CAGAGGGAATGGTGGCCAGTTGG + Intronic
932338913 2:70947426-70947448 CTGCTGGTATGGGGACCACACGG + Intronic
933854482 2:86400027-86400049 CTGAGGGTGTGGGGGGCAGCAGG + Intergenic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
935989241 2:108704714-108704736 CTGGGGATATGGGGGACAGGTGG - Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
938250985 2:129815571-129815593 CTGAGGCTGTGGGGGGCAGTGGG - Intergenic
939144567 2:138396738-138396760 CTGAGGTTGTGGTGGCCACAGGG + Intergenic
939162241 2:138604392-138604414 TTGAGGATTTGGGGGCCAGTGGG - Intergenic
939340942 2:140895525-140895547 CTGAGGCTCTAGGGGCCACACGG - Intronic
943740277 2:191399882-191399904 CTGATTTTATGGGGGCCAGGAGG - Intronic
944157624 2:196623902-196623924 TTTAGGGCATGGGGGCCAAATGG + Intergenic
946190402 2:218004820-218004842 CTTAGAGTAGGGGGTCCAGAGGG - Intergenic
946902036 2:224382165-224382187 CTGAGGGTTTGCCGGCCATATGG + Intronic
947623182 2:231604058-231604080 AAGAGGGCATTGGGGCCAGAAGG - Intergenic
947878079 2:233480863-233480885 CTGAGGGTGTGGGAACCTGAAGG + Intronic
948230835 2:236348354-236348376 CAGAGGGTATGGTGCCCAGCCGG - Intronic
948267376 2:236644887-236644909 CTGTGGTCATGGGGGCAAGATGG - Intergenic
948817690 2:240521141-240521163 CTGGGGGTAGGGGGCCCAGATGG + Intronic
1170330725 20:15207740-15207762 CAGAAGTAATGGGGGCCAGAGGG - Intronic
1172035025 20:32004576-32004598 GAGAGGCTATGGGGGCCAGGTGG - Intergenic
1174104781 20:48154472-48154494 CTGTGGGTATGAGGCTCAGAGGG + Intergenic
1175277133 20:57779828-57779850 CTGAGGTTATGGGGGCAAAGGGG + Intergenic
1175949755 20:62577045-62577067 CTGAGGGTCTGGGAGTCAGCTGG - Intergenic
1179044067 21:37829515-37829537 CTGGGTGTGTGGGGGCCAGGGGG + Intronic
1179182402 21:39057139-39057161 CTAAGGGCATGGGGGCAGGAGGG - Intergenic
1180246917 21:46554632-46554654 CTGAGGGTGCGGGGGCCGCACGG - Exonic
1181463061 22:23096630-23096652 CTCAGGGTGTGGAGGCCACAGGG + Intronic
1181854541 22:25772545-25772567 CTGAGGGCAGGGGGGCCTGGGGG + Intronic
1182027009 22:27128094-27128116 CAGAAGCTATGGGGCCCAGAAGG - Intergenic
1183379705 22:37484773-37484795 CTGAGGTGCTGGGGGCCAGCTGG + Intronic
1183617458 22:38954329-38954351 GTGGGGGTATGGGGGACAGAGGG + Intronic
1183724845 22:39582781-39582803 GTGAGTGTATGGGGGAAAGATGG - Intronic
1184103538 22:42354229-42354251 GAGAGGAAATGGGGGCCAGATGG - Intergenic
1184351096 22:43944809-43944831 CTGTGGGTGTGTGGGCCGGACGG + Intronic
950218196 3:11174777-11174799 CCGAGGCTGTGGGGGCCAGCTGG - Intronic
950249922 3:11456148-11456170 CTCAGGGTTAGGGGGCCAGAGGG - Intronic
950521470 3:13500358-13500380 GTGGTGGTATGGGGGCCACACGG - Intronic
950774315 3:15336557-15336579 ATGAGGGGATGTGGGGCAGAGGG + Intronic
952019884 3:29005464-29005486 CTGAGGCTATGGGAACCAAAGGG - Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952943379 3:38459710-38459732 CTCAGGGTGTGGTGGCCAGATGG + Intronic
954137866 3:48590397-48590419 ATGAGGGTATGGGTGCCAGAGGG - Intronic
954150212 3:48653586-48653608 CTGAGGGTATAGGGGTGAGCAGG + Intronic
955555590 3:60133605-60133627 CTGAGAGTGTGGGGACCAGGGGG + Intronic
960670714 3:120153178-120153200 CTGAGGGCAGGGGGCCCAGCTGG + Intergenic
960944822 3:122958668-122958690 CTGGGGGACTGGGGCCCAGAGGG + Intronic
961551049 3:127670930-127670952 CTGAGGGCATGCAGGCCACATGG - Intronic
967099110 3:186201304-186201326 CTGATGGCCTGGGGGCCAGCAGG + Intronic
967167033 3:186790467-186790489 CTGGGGGCACGGGGGCCAGTTGG - Intronic
967681218 3:192366153-192366175 CTGAGGGTTGGGGAGCAAGAAGG + Intronic
967967065 3:194970058-194970080 CTGAGGGGATTGGGGGCTGAGGG - Intergenic
969889139 4:10243493-10243515 CTGTGGATATGGGAGCCAGTGGG - Intergenic
971667724 4:29512286-29512308 CAAAAGGTATGTGGGCCAGAGGG + Intergenic
974879460 4:67735976-67735998 CTGAGGGGAAGGGTGACAGAGGG + Intergenic
976077090 4:81312144-81312166 CTGAGGATTTGGAGGCAAGAAGG + Intergenic
977985674 4:103380000-103380022 CTGAGGCAATGGTGGCCACAGGG + Intergenic
979626268 4:122848614-122848636 CTGAGGATATGGGCCACAGAGGG + Intronic
980076688 4:128301544-128301566 CTGAGGGCATGGGGGACACCTGG - Intergenic
982073755 4:151718550-151718572 CTGAGAGGCTGGAGGCCAGAGGG + Intronic
983844536 4:172500527-172500549 CTGAAACTATGGAGGCCAGAAGG + Intronic
985761912 5:1753250-1753272 CTGAAGGCAAGGCGGCCAGACGG - Intergenic
986012552 5:3729193-3729215 CTGAGGGTGTGGGGGCCCCAGGG + Intergenic
992885040 5:81150121-81150143 CTTAGGGTACGTGGGCCATAAGG + Intronic
997250717 5:132386710-132386732 CTGAGGAGATGGGTGCAAGATGG - Intronic
997259743 5:132456775-132456797 CTGAGGGTCTACAGGCCAGAGGG - Intronic
997348272 5:133209867-133209889 ATGAGGCTCTGGGGTCCAGAAGG - Intronic
997380287 5:133431109-133431131 CTGGGGGAATGGGGGCCTGGGGG - Intronic
997723987 5:136105016-136105038 CGGAGGGAATGGGGGTGAGAGGG + Intergenic
998401993 5:141852993-141853015 CTGAGGCTGTGGGGGGCAGCTGG - Intergenic
999151674 5:149430444-149430466 CTGGGGGTGGGGGCGCCAGAGGG + Intergenic
1001528340 5:172444942-172444964 CTGTGGGTAGAGGGGCCAGAAGG - Intronic
1001571772 5:172735053-172735075 TTGTGTGTATGGGGGCCAGTTGG + Intergenic
1001746947 5:174099442-174099464 CTGAAGGCAAGGGGGCCAGTGGG - Intronic
1002660841 5:180790369-180790391 CCCAGGGGATGGGGGCCAGGTGG - Intergenic
1004356442 6:14933520-14933542 CTGAGGGTGGGAAGGCCAGAGGG + Intergenic
1004620509 6:17326703-17326725 CTGAGGGCCTGGAGGCCAGGAGG + Intergenic
1005995106 6:30926044-30926066 CTGAGGGAATGTGGGCCAGGAGG + Intronic
1006516154 6:34546813-34546835 CTGGGGATGTGGGGGACAGAGGG + Intronic
1007248562 6:40480169-40480191 ATGAGGAAATGGAGGCCAGATGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1010632337 6:78213079-78213101 CCAAGGGTATGGGAGCCAGAGGG - Intergenic
1012231296 6:96763254-96763276 CTGCGAGTATGGGAGCCACATGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1017399828 6:154047307-154047329 CTGAGGGCCTGGGTGCAAGATGG + Intronic
1017514485 6:155143722-155143744 ATGAGGGCTTTGGGGCCAGAGGG + Intronic
1018743779 6:166748769-166748791 CTGAGGAAATGGGGGCCCAAGGG - Intronic
1018743825 6:166748880-166748902 CTGAGGAAATGGGGGCCCAAGGG - Intronic
1018743872 6:166748992-166749014 CTGAGGAAATGGGGGCCCAAGGG - Intronic
1018812510 6:167308132-167308154 CTGAGGGAATGGTGCCCAGAAGG - Intronic
1018908815 6:168090216-168090238 CTGAGAGCGTGGGGGGCAGAGGG - Intergenic
1019485216 7:1286129-1286151 CTCAGGGTATGACGGGCAGAGGG + Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1020198144 7:6058650-6058672 CCCAGGGCATGGGGGCAAGACGG + Intronic
1020456865 7:8383870-8383892 CTGAGGGAAAGGGGGAAAGAAGG + Intergenic
1021550708 7:21868246-21868268 TTGACTGTATGAGGGCCAGAGGG + Intronic
1022108303 7:27212626-27212648 CAGAGGGTGTGGGGCCTAGAGGG + Intergenic
1023844147 7:44111750-44111772 CCGAGGGTCTGGGGGACAGCTGG - Intronic
1023863173 7:44227305-44227327 AGGAGAGTATGGGGGACAGAGGG + Intronic
1023863244 7:44227503-44227525 AGGAGGGTGTGGGGGACAGAGGG + Intronic
1023863265 7:44227559-44227581 AGGAGGGTCTGGGGGGCAGAGGG + Intronic
1023863279 7:44227595-44227617 CAGGGGGTGTGGGGGACAGAGGG + Intronic
1023863328 7:44227747-44227769 AGGAGGGTGTGGGGGACAGAGGG + Intronic
1023863341 7:44227786-44227808 AGGAGGGTGTGGGGGACAGAGGG + Intronic
1023874462 7:44279209-44279231 CCCAGGGTCTGGGGCCCAGATGG + Intronic
1023965535 7:44961619-44961641 CTGAGGGGCTGAGGGCCTGAGGG + Intergenic
1025092947 7:56078282-56078304 CTGAGGTCCTGGGGGCCAAATGG - Intronic
1026946124 7:74317421-74317443 TTGAGGGTCTGGGGGCCATTGGG + Intronic
1026952075 7:74354195-74354217 ATGAGAGTATGGAGGCCAGGAGG + Intronic
1027418585 7:77998157-77998179 CTGAGGGTATGCCCGCCACAGGG + Intergenic
1030125806 7:106151578-106151600 CTTAGAGTAAGGGGGCCAGAGGG - Intergenic
1030357572 7:108559234-108559256 CATAGGGTATGGGAGCTAGACGG + Intronic
1031985756 7:128163736-128163758 CTGATGGCAATGGGGCCAGAAGG - Intergenic
1033545380 7:142394788-142394810 CAGATGATATGGGGGTCAGAGGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034341722 7:150361529-150361551 CTGAGGGCTTGGGAGACAGAGGG + Intergenic
1036622574 8:10434570-10434592 GTGAGGGCATGGGGGGCATACGG - Intergenic
1040675581 8:49745557-49745579 ATGAGGATATGGGCACCAGATGG + Intergenic
1040850858 8:51899181-51899203 CTGAGGGGGGCGGGGCCAGATGG - Intronic
1042330688 8:67577251-67577273 ATGAGGGTATGAGTGACAGATGG + Intronic
1046763932 8:118049500-118049522 CAAAGGGAAAGGGGGCCAGAAGG + Intronic
1049023054 8:139970858-139970880 CTGAAGGGATGGGGGCCACGTGG + Intronic
1049443480 8:142619608-142619630 CTGATGGCCTGGGGGCCAGTGGG + Intergenic
1049472816 8:142783880-142783902 CTGAGGGGCTGGGGGCGAGTGGG - Intergenic
1049476431 8:142799177-142799199 CTGAGGGTCTGGGGGCAAACGGG - Intergenic
1049702429 8:144021259-144021281 CTGAGGGAAGGGGGTCCTGAAGG - Intronic
1049703189 8:144024202-144024224 CTGAGGGTAGAGGGTCCTGAGGG - Intronic
1049703241 8:144024380-144024402 CTGAGGGAAGGGGGTCCTGAGGG - Intronic
1050726914 9:8660567-8660589 CTGAGGGGCTGGGAGCCAGCTGG - Intronic
1052626021 9:30978470-30978492 CTGCAGGTATGGGGCCCATATGG + Intergenic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1058545893 9:106059916-106059938 CTGAGCCTGTGGGGGCAAGAGGG + Intergenic
1061304193 9:129723077-129723099 CAGAGGGTGTGTGGGACAGATGG + Intergenic
1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG + Intergenic
1062304440 9:135895392-135895414 CTGAAGCTATGGAGGCCAGAGGG + Intronic
1062321416 9:135992339-135992361 CTCTGGGTAGGGTGGCCAGAGGG - Intergenic
1062563846 9:137154929-137154951 CTGAAGGTCTGGGGTCAAGAAGG - Intronic
1185891069 X:3822481-3822503 CTCAGGGTATGGTGGCCAATGGG + Intronic
1185896173 X:3860897-3860919 CTCAGGGTATGGTGGCCAATGGG + Intergenic
1185901292 X:3899323-3899345 CTCAGGGTATGGTGGCCAATGGG + Intergenic
1186559482 X:10595658-10595680 CTGAGGGTATGGGGGAAGGGAGG + Intronic
1186780044 X:12903288-12903310 CTGATGGTCTGTGGCCCAGATGG - Intergenic
1187701470 X:21967983-21968005 CGGAGGGGCTGGGGTCCAGATGG + Intronic
1188387225 X:29575849-29575871 CTGAGGGTATAGCTTCCAGAGGG + Intronic
1189990969 X:46594596-46594618 CTGAAAGCATGGGGGTCAGAAGG - Intronic
1190164856 X:48064962-48064984 CTGAGGCTTTGTGGGCCATACGG - Intronic
1192698827 X:73446892-73446914 CTGACGCTATGGGGACCAGATGG + Intergenic
1195160112 X:102162578-102162600 CTGAGGCTATGTGGGGCAGTTGG + Intergenic
1196795100 X:119495931-119495953 CTGAGGGTACGGGGGCCCCAGGG + Intergenic
1198674139 X:139113874-139113896 CTGAGAATATTGGAGCCAGAAGG - Intronic