ID: 902509163

View in Genome Browser
Species Human (GRCh38)
Location 1:16956200-16956222
Sequence AAGGGGGAGCTATTGGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902509163_902509172 13 Left 902509163 1:16956200-16956222 CCCCGGGCCAATAGCTCCCCCTT 0: 1
1: 0
2: 0
3: 9
4: 104
Right 902509172 1:16956236-16956258 TTCTACCCCTATGTAAAACCAGG 0: 1
1: 0
2: 0
3: 3
4: 82
902509163_902509173 14 Left 902509163 1:16956200-16956222 CCCCGGGCCAATAGCTCCCCCTT 0: 1
1: 0
2: 0
3: 9
4: 104
Right 902509173 1:16956237-16956259 TCTACCCCTATGTAAAACCAGGG 0: 1
1: 0
2: 0
3: 14
4: 118
902509163_902509174 15 Left 902509163 1:16956200-16956222 CCCCGGGCCAATAGCTCCCCCTT 0: 1
1: 0
2: 0
3: 9
4: 104
Right 902509174 1:16956238-16956260 CTACCCCTATGTAAAACCAGGGG 0: 1
1: 0
2: 1
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902509163 Original CRISPR AAGGGGGAGCTATTGGCCCG GGG (reversed) Intronic
900192264 1:1356519-1356541 GAGGGGGAGTTATTGGCAAGGGG + Intronic
900630160 1:3630650-3630672 TGGCGGGAGCTAGTGGCCCGGGG + Intergenic
902332316 1:15736594-15736616 CAGGGGGAGCTGCAGGCCCGGGG + Exonic
902509163 1:16956200-16956222 AAGGGGGAGCTATTGGCCCGGGG - Intronic
903338596 1:22640872-22640894 GAGGGGAAGCAATTGGCCCAAGG + Intergenic
905431995 1:37931378-37931400 GAGGGGCAGCGAGTGGCCCGAGG + Intronic
909810484 1:79926361-79926383 AATGGGGAGATATTGACCCAAGG - Intergenic
911294213 1:96094131-96094153 AAGGGAGAGGTATTGGCCAAAGG + Intergenic
920172019 1:204078106-204078128 AAGAGGAAGGTATTGGCCGGGGG - Intronic
924244157 1:242065434-242065456 AACGGGGAGCTATCGTTCCGTGG - Intergenic
924428176 1:243972893-243972915 AAGGGGGAGCAACTGGGCCAAGG + Intergenic
1062763102 10:42304-42326 AAAGGGGAGCTATTGTTCCGTGG + Intergenic
1063468275 10:6262859-6262881 AAGGGGGAGCTGCTGTCCAGCGG + Intergenic
1065109753 10:22428005-22428027 AAAGGAGAGCTATCGGCCAGGGG - Intronic
1067041633 10:42956189-42956211 AAGGAGAAGCTATTGGCAAGAGG - Intergenic
1070498297 10:77045567-77045589 ATGGGGGAGCTGTCTGCCCGTGG - Intronic
1072050714 10:91700521-91700543 AAGGGGTTGCTCTTGGCCAGAGG - Intergenic
1073139367 10:101237299-101237321 AGGGCGGAGGTCTTGGCCCGAGG - Intergenic
1076731056 10:132439073-132439095 CAGGGGGTCCTATTGGCCCTGGG + Intergenic
1076791859 10:132780957-132780979 AAGGGGAAGCTAGGGGGCCGGGG + Intronic
1077210588 11:1369394-1369416 AATGGGGACCTACTGGCCAGTGG + Intergenic
1080174915 11:29351492-29351514 AAGAGGGAGTTATTTCCCCGGGG - Intergenic
1080457779 11:32431296-32431318 AAGAGGGAGCCTTTGGCCCTCGG + Intronic
1082884596 11:58068978-58069000 AAGGGAGAGCAAATGGCCCAGGG + Intronic
1083330871 11:61897813-61897835 AAGGGGGTGCTGCTGGCCCAGGG + Exonic
1083430737 11:62612617-62612639 GAGGGGGCGCTGTGGGCCCGGGG + Exonic
1089743910 11:120603790-120603812 GAGGGGGTGCTACTGGCACGTGG + Intronic
1090135744 11:124198040-124198062 AAGGGGAAGATATTGGCCAAAGG - Intergenic
1091303316 11:134521646-134521668 AAGGGGAATCCACTGGCCCGTGG - Intergenic
1094812996 12:34159981-34160003 AATGGGGAGCTATTGTTCCGTGG + Intergenic
1097093110 12:56523207-56523229 AATGGGGAGCTATAGGTCAGAGG + Intronic
1097431414 12:59512508-59512530 AAGGGGGAGATGTTGGTCAGAGG + Intergenic
1103484631 12:121274278-121274300 AAGGGGGACCTCTTGGCCATCGG + Exonic
1103696836 12:122822485-122822507 AAAGGGGAGCTATTGGTCAAAGG - Intronic
1108025195 13:46170292-46170314 AAAGGGCAGCTGCTGGCCCGAGG + Intronic
1112337551 13:98527564-98527586 AAGGGGGTGCCGGTGGCCCGTGG - Intronic
1115028127 14:28766437-28766459 AAATGTGAGCTATTGGCCCTAGG + Intergenic
1115280121 14:31652302-31652324 AATGGGGAGATATTGGCCAAAGG + Intronic
1118466129 14:66032858-66032880 AAGCAGGAGCTATTGGTCAGTGG - Intergenic
1119510993 14:75211119-75211141 ACGGGGGAGCTGTTGTCCAGTGG - Intergenic
1121168981 14:91836828-91836850 GAGGGGAAGCTATTGGCCTGAGG + Intronic
1123802519 15:23836040-23836062 AATGGGGAGATATTGGCCAAAGG - Intergenic
1123946317 15:25240559-25240581 ACAGGGGAGCTCTTGGCCCCCGG + Intergenic
1124369773 15:29097789-29097811 AAGGGGGAAGTATTGGTCCACGG - Intronic
1124996544 15:34728475-34728497 AATGGGGAGATGTTGGCCCAAGG + Intergenic
1133858342 16:9570934-9570956 AAGAGGGAGCAAGTGGCCTGAGG + Intergenic
1138247683 16:55479480-55479502 ATGGAGGCGCTAATGGCCCGGGG + Exonic
1145931436 17:28688721-28688743 AATGAGGAGCTATGTGCCCGTGG - Intronic
1147210749 17:38871133-38871155 AAGGGGGAGGTATTGGGGGGAGG + Intronic
1148824030 17:50378927-50378949 AAGGGGCAGCTCTTGGGCCAAGG + Intronic
1152956011 18:42635-42657 AAAGGGGAGCTATTGTTCCGTGG + Intergenic
1160343817 18:78112826-78112848 AACGGGGAGCGATTGGGCTGTGG - Intergenic
1163500947 19:17675841-17675863 GAGGGGCAGCCATTGGCCTGGGG - Intronic
926565406 2:14464129-14464151 AATGGAGAGCTATTGGTCCAAGG + Intergenic
926808366 2:16734085-16734107 AATGGGGAGCAACTGGCCCAAGG - Intergenic
934856082 2:97731262-97731284 GAGGGAGGGCTATTGGCCCTGGG - Intronic
935760207 2:106313313-106313335 AAGGGGGTGCTCCTGGCTCGTGG + Intergenic
936161280 2:110085895-110085917 AAGAGGGAGTTGTTGGCCAGGGG - Intronic
936183383 2:110285459-110285481 AAGAGGGAGTTGTTGGCCAGGGG + Intergenic
939576577 2:143902247-143902269 AAGGGGGAGATATTGGTCAAAGG + Intergenic
942302101 2:174572141-174572163 AAGGGGGAGGAGTGGGCCCGGGG + Exonic
944766787 2:202872022-202872044 AAGTGGAAGGCATTGGCCCGGGG + Intergenic
945789428 2:214286182-214286204 AAGGGGGAGATGTTGGTCTGGGG + Intronic
946432842 2:219634738-219634760 TGGGGGGAGCTGTTGGCCCAGGG + Intronic
1169557601 20:6767605-6767627 AAGGGGGAGGTGTTCGGCCGCGG + Intergenic
1172118207 20:32583894-32583916 AAGGGGGAACGAGGGGCCCGGGG + Intronic
1173988155 20:47278905-47278927 AAGGGGGAGTCATTTGCCCTAGG - Intronic
1174095711 20:48088003-48088025 AGGGGGGACCTTGTGGCCCGAGG + Intergenic
1174502449 20:50995641-50995663 AAGGAGGAGCTATTAGGCCCAGG - Intergenic
1174559104 20:51417293-51417315 AAGGGGAAGCTACTGGCAGGTGG - Intronic
1175032439 20:55969358-55969380 AAGTGGAAGCTTTTGGACCGAGG - Intergenic
1175989262 20:62779340-62779362 AAGCAGGAGCTGTTGGCCCCGGG + Intergenic
1179934293 21:44592570-44592592 AAGGGGAAGCTGTGGGCCCGGGG - Intronic
1181163853 22:20973351-20973373 AAGGAGGAGCTGTCGGCCAGTGG + Exonic
1181688502 22:24545088-24545110 CAGGGGGAGCTCTAGGCCAGGGG + Intronic
1184660773 22:45964605-45964627 AAGGGGGAGTGGGTGGCCCGGGG - Intronic
1184838495 22:47038346-47038368 AAAGGGGAGCTCTTGGCGGGAGG + Intronic
950020503 3:9784157-9784179 AAGGAGGAGCTAATTGCCCAGGG - Exonic
952102972 3:30036245-30036267 AAGGGGGAGATTTTGGCTCAGGG + Intergenic
955778916 3:62462954-62462976 AAGTGGGTGCTTTTGGCCTGGGG + Intronic
956891947 3:73622385-73622407 AAGGGGAAAATATTTGCCCGAGG - Intronic
968358333 3:198125601-198125623 AAAGGGGAGCTATTGTTCCGTGG - Intergenic
968872018 4:3247044-3247066 AAGGGGCAGCTGCTGGCCAGTGG - Intronic
972398916 4:38681746-38681768 AAGGGGGAAAACTTGGCCCGAGG + Intronic
973230401 4:47834455-47834477 AATGGGGAGGTATTGGACCAAGG + Intronic
974966250 4:68763786-68763808 AAGTGGGAGCTTTTGGACAGGGG + Intergenic
985525881 5:401416-401438 AAGGGGGTGGGATTGGCCCATGG + Intronic
985626307 5:990363-990385 CAGGGGGAGCCATTGACCTGCGG + Intergenic
987183099 5:15386613-15386635 AAGGGGAAGCTATGGGCACTTGG + Intergenic
990041591 5:51383563-51383585 AAGTGGGAAATATTGGCCCCTGG - Exonic
997618619 5:135270566-135270588 GAGGGGGAGATATTGGCGAGGGG - Intronic
997618624 5:135270583-135270605 GAGGGGGAGCTCTTGGCGAGGGG - Intronic
1000393760 5:160751269-160751291 AAGGGGGAGCAATGAGCCTGGGG - Intronic
1002350486 5:178579944-178579966 GAGGGGCAGCGATTGGCCCCTGG - Intronic
1006813395 6:36835385-36835407 AAGGAAGAGCTCTTGGCTCGAGG + Intronic
1010580104 6:77585949-77585971 AAGGGGGAGCTATTGATTAGAGG + Intergenic
1016934671 6:149440925-149440947 CAGGGGGAGCTGGTGGCCCTGGG - Intergenic
1019548536 7:1590780-1590802 AAAGGGGAGATAGGGGCCCGGGG + Intergenic
1022580916 7:31553241-31553263 ATGTGGGAGCTTTTGGCCAGGGG + Intronic
1025723661 7:64038202-64038224 AAGGTGGAGCTAATGACCCGTGG + Intronic
1025752810 7:64307798-64307820 AAGGTGCAGCTAATGGCCCGTGG + Intronic
1025929535 7:65982679-65982701 AAGAGGGAGCTCTTGGCCCCTGG - Intergenic
1027916229 7:84325888-84325910 AATGGGGAGATGTTGGCCAGAGG - Intronic
1029175543 7:98662091-98662113 AAGGGAGAGCAATGTGCCCGAGG + Intergenic
1038266311 8:26042047-26042069 AAGAGGGAGTTATTAGGCCGCGG + Intronic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1058670533 9:107357313-107357335 AAGGGGCAGCAATTGGACCTTGG + Intergenic
1060202137 9:121657445-121657467 CAGGGGGAGCTCTTGGCATGGGG - Intronic
1061872390 9:133527906-133527928 CAGGGGAAGCGATTGGCCTGGGG + Intronic
1062165075 9:135103593-135103615 AAGAGGGAGCCCTTGGCCCACGG + Intronic
1062742204 9:138182139-138182161 AGAGGGGAGCTATTGTTCCGTGG - Intergenic
1189367818 X:40402781-40402803 AGGAGGGAGCTCTTGGCCCTGGG - Intergenic
1200253214 X:154564725-154564747 AAGAGGGAGGGATTAGCCCGAGG - Exonic
1200264553 X:154639690-154639712 AAGAGGGAGGGATTAGCCCGAGG + Intergenic